Dataset for CDS BCL-2-like of organism Dipodomys ordii

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A1S3EPX7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Dipodomys ordii GN=BCL2L1 (length=705 residues).
atgtctcagagcaaccgtgagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagcgatgtggaagagagcaggactgaggacccagaaggaactgaatcggagatggagacccccagtgctatcaatggca
acccatcctggcacctggcggacagccccgcggtggtgaatggagccacgggtcacagcagcagttcggaagcccgggaa
gtgattcccatggcagctgtgaagcaagcgctgagggaggcaggcgatgagtttgaactgcggtatcgacgggcattcag
tgacctgacatcccagctccatattaccccggggacagcatatcagagctttgagcaggtagtgaacgaactcttccggg
atggggtaaactggggtcgaattgtggcctttttctccttcggcggggcactgtgtgtggaaagcgtagacaaggagatg
caggtattggtgagtcggatcgcaagttggatggccacttacctgaatgaccacctagagccttggatccaggagcacgg
cggctgggacacttttgtggaactctacgggaacaatgcagcagctgagagtcggaagggccaggagcgcttcaaccgct
ggttcctgacgggcatgaccgtggccggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|A0A1S3F3I1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Dipodomys ordii GN=MCL-1 (length=1050 residues).
atgtttggcctcagaagaaacgcggtaatcggactcaacttctactgtgggggcgccgggctgggcgccggcagcggggc
cgccgccgcgccgggagggcggctcttgacggcggaggaggccagtgcccggcgggaggcggggggaggggaagccggcg
cggggattggcggaagcgccggcgcgagcccctcgaccaccctggcgccggacgcccggagggtcgcgcgtcccgcgccc
attggcgccgaggtccccgacgtcaccgggaccccaactaagcgggtgttcttcgcgcccacccaccgtgcgccgacgcc
ggacgagatggaagccgcggccgccggcgccatcatgtcgcccgaagaggagctggacggctacgaacccgagcccctgg
ggaagaggccggccgtcctgcccctgctggagctggtcggggaagccagtaagagctcgcgcacggacggctcgctccct
tccacgccgcctccagcggaggaggaggacgacgagttgtaccggcagtcgctggagattatctgtcgctaccttaggga
gcaagccacgggcgccaaggacgccaagccgctgggtggggccggcgcggccagcaggaaggcgctggagaccctgcggc
gggtcggggacggggtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaagac
gacgtcaaatctttatctcgagtgatgatccatgttttcagtgacggcgtaacaaactggggtaggattgtgactctaat
ttctttcggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagtatca
cagatgttctcgtaaggacaaaacgggactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgta
gaggacctagaaggcagcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatct
cataagatag
>gnl|bcl2dbcds|A0A1S3FYD8_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Dipodomys ordii GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctggtggctgactttgtaggctataaactgaggcagaagggtta
tgtctgtggagcgggccctggggagggcccagcagctgacccactgcatcaagccatgcgggcagctggagatgaatttg
agacccgcttccggcgcaccttctctgatctggcagctcagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgatgaacttttccaaggaggccccaactggggccgtcttgtggccttctttgtctttggggctgccctgtg
tgccgagagtgtcaacaaagaaatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcgcc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcatcagtgaggacagtgctgacgggggccgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
© 1998-2018