Dataset for CDS BCL-2-like of organism Dicentrarchus labrax

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A1X9JZA1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Dicentrarchus labrax GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaacattgtggaaaagtatatctgccataaactctccaaacagggctacgagtgggggtt
tgacgctgtccggaatgcagatgccggtaataatgggtcaatagttgcccctccaccgagtttggtccgccggtgccgtg
gagccagcaccgggcccgacagcgagagcatcccccacctctgcacacggctcccccagtccgacccgcatgccgccatc
cacagagtcctacgcgaggctggagacgaacttgaaagactgtaccagccggacttcacggagatgtcgcggcagctgta
tctcacctccaccacggcgcagaggagattcgccgacgtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcgggggcacggtgtgcgtggagtgcgtggcgaaggaggagatggcagcgcaggtgaacaac
atcgcggagtggatgactgagtatttaaatggacctctgaacagctggatacaagataacgggggatgggatgcctttgt
ggagctgtatgacagacagagggactccgtcttcagttgctcctggccctccattaagacggtcttcggtgtggctgcgc
ttggagcagctagcctcaccatcggagcgtaccttacacagaagtga
>gnl|bcl2dbcds|E6ZFR0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Dicentrarchus labrax GN=BCL2L1 (length=663 residues).
atgtcgtacagtaacagagagctggtggagttctttataagctataaactgtctcagaggaaccacccaacctctctact
gaggccggagaatgccggtgaaaggactgagggagacaaggccaactcagctgccagaaacggcttgctggccagcaaga
acacaagtggccagccggggacgtcttcgtcctcaggcgctgacatagaggctgtaaaggcagctcttcgggactcggca
gatgagtttgaactgctcttcacgcaagcgtttagtgacctttcctcgcagattgacatcactcctgacacggcctacca
cagctttaaaagcgtgatggacgaggtgttcaaggatggagtgaactggggacgtatagtgggcctgtttgcctttggcg
gtgtactgtgtgtagaatgtgtcgagaaagatatgagtgagctggtttcccgcatcgcagactggatgaccatgtacctg
gatgagcacatcagtccgtggatccagagccaaggaggatgggactgctttgctgaggtttttgggcgagacgccgccgc
agaagcgaggagatctcgggagactctgagtagatggctgctaattggggtggcgctgctaatgggagctgtggtcgggg
ttctcattgctaagaaacattga
© 1998-2018