Dataset for CDS Unclassified of organism Danio rerio

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F8W266_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Danio rerio (length=630 residues).
atggcacaggagaatgtgtataataaccgcagtatagtggaaaattacatccaccataagctgtggaagaagggatacgt
ttgggaagtgaatggacatgacagtgtctcgaatggactgagtatggggaggcaggagaacagcgtcgtctctcccagct
cccgtcacgacccatacagcgctcttcataacgtgctacgggaggctggggatgaactggagagtttatatcagtcggac
tttgcggagatgtccaaacagttgcacgtcacgtccatcacggcacatcagcgcttcaacgcagtcatagatgagctgtt
cagggacggcgtgaactggggcagaataatcgcttttttcgagtttgggggcaccgtttgtgctgaatgcgtgaataagg
agatgacggggcaggtggataacattgctgtctggatggcagactacctgaacgggccgcttcacggttggatccgggag
aacggcggttgggaagcatttgtggagctctacagcagccagagggattctgtgtttcacagttcatggtcatcaatagt
aacggtctttggtctagctgctctcggggctgttggcttgaccataggagcctaccttgctcaacaataa
© 1998-2018