Dataset for CDS BCL-2-like of organism Danio rerio

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|F8W4Q8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=390 residues).
atgattctctggactctttcaggtatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagca
agtggcaacagagctctttagcgatggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgt
gcaaataccagaatgacagaggacatagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagag
cagcgggactggatactcagaaacaaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgt
gagaaacacacttctaacaattggtggtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|F8W4Q8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=687 residues).
atgttcgctggaagaaacaacgacaacggcttttggccatgcactggattacaaagcaaaccactggttattccagaact
gaaagcgcataaccagtttgcggtggactctctccagggctcggtaccgtcctcgccttcggacgaaacgggggattatc
cccccaccgcccttgacatggacacgcgggagattattgacactttcttaaaaatctttacaggactccctcattctaaa
agtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaagg
tatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctctttagcg
atggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgtgcaaataccagaatgacagagga
catagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagagcagcgggactggatactcagaaa
caaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacacttctaacaattg
gtggtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|Q1L8X3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=768 residues).
atggctctgagtttggattttaggcgaacggccacgatgagcttcttcgcgcagggcgttcaaactccgacgctaaagac
gtgcgtcgaagacgaactggacggatacattgaggaggaggaggcgcctctgaagcggcttagaccgggtacaaacggcc
tgaaggggctgcagctggacggtcgatttgtttctgcgacagacggatctctaccgaccaccccagatccggaggagctc
gactacgccgaactggaacgcgatactcggcagctcttattggatttttaccgcacacacacgggaatgtgtccggtaga
ccgtaaactccatcacgccataccgacgatgaagcgagtggtcgacaatattctcgtgaagcaccagatcgcatacaaag
gaatgatccagcgtcttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatgtttaaa
gatggcgtcactaactggggccgaattgcgagtctggtggcgttcggggccgtggtttgctctcgattgaaggagctcca
gcaggatcagtgtgtggagagggtggctgagcagatctcctcatatctgacctcagaacagcaggactggatcctcaaaa
acaagagctggcatgggttcgtggagtttttccaccaggaggacgtagagtctgttgtccgtcatggtctgttggcgctg
gtcggatgtgccggtatcggtgccggtctggccttcctcatccggtga
>gnl|bcl2dbcds|Q564A4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Danio rerio GN=BCL-2 (length=687 residues).
atggctaacgaaattagctatgacaatcggaatattgtggagaaatacctcaagcataaactttcaaagcgaggatatgt
gtggaaatgtcagtcctctgctgaggaagatgacaccttcaataaagcagtggaggaatcctctccaaactctgacagga
ggcttcaggctccctcagccggcggagggaacaactctgaatgcctgatagcccgggtcactcgttcagaccctcatttg
aggctctaccgggtgttacgggatgctggagatgaaatagaaaggatttaccaacgcgaatttgaggaaatgtcccaaca
aatggtgttcaacccaaattctgcgcaacgcagctttctaaccgtggccgaagagctctttagagacggagtgaactggg
ggcggatcattgcattcttcgagtttggtgggaccatgtgcgtggaaagcgtcaaccgggagatggcgtcccaggtagat
aatattgcacactggatgactgactacctgaacgggccactggaaaactggatcgaggaaaatggaggttgggatgcctt
cgtggagatgtacggtcagcagagagactctgtgttccacccgttttcatacctaacaaaagtgctcggcttggcggcgc
tgggcttggcaggagtgaccatcggagccttttttgctcagaagtga
>gnl|bcl2dbcds|Q568V1_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=732 residues).
atgagcttcctcgcgcagggcgttcaaactccgacgctgaagacgtgcgtcgaagacgaactggacgggtacattgagga
ggaggaggcgcctctgaagcggcttagacctggtacaaacggcctgaaggggctgcagctggacggtcgatttgtttcta
cgacagacggatctctaccgaccaccccagatccagaggagctcgactacgccgaactggaacgcgatactcggcagctc
ttattggatttttaccgcacacacacgggaatgtgtccggtagaccgtaaactccatcacgccataccgacgatgaagcg
ggtggtcgacaatattctcgtgaagcaccagatcgcatacaaaggaatgatccagcgtcttcagctggactctcagccgg
cctctctggacttcatcagatgtatagcaagcaccatgtttaaagatggcgtcactaactggggccgaatcgcgagtctg
gtggcgttcggggccgtggtttgctctcgattgaaggagctccagcaggatcagtgtgtggagagagtggctgagcagat
ctcctcatatctgacctcagaacagcaggactggatcctcaaaaacaagagctgtcatgggttcgtggagtttttccacc
aggaggacgtagagtctgttgtccgtcatggtctgttggcgctggtcggatgtgccggtatcggcgccggtctggccttc
ctcatccggtga
>gnl|bcl2dbcds|Q568W5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=687 residues).
atgttcgctggaagaaacaacgacaacggcttttggccatgcactggattacaaagcaaaccactggttattccagaact
gaaagcgcataaccagtttgcggtggactctctccagggctcggtaccgtcctcgccttcggacgaaacgggggattatc
cccccaccgcccttgacatggacacgcgggagattattgacactttcttaataatctttacaggactccctcattctaaa
agtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaagg
tatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctctttagcg
atggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgtgcaaataccagaatgacagagga
catagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagagcagcgggactggatactcagaaa
caaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacacttctaacaattg
gtggtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|Q8UWD6_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=687 residues).
atgttcgctggaagaaacaacgacaacggcttttggccatgcactggattacaaagcaaaccactggttattccagaact
gaaagcgcataaccagtttgcggtggactctctccagggctcggtaccgtcctcgccttcggacgaaacgggggattatc
cccccaccgcccttgacatggacacgcgggagattattgacactttcttaaaaatctttacaggactccctcattctaaa
agtggacgaaaacaagtactgtcaacaatgaggcgggttgtggacaatctcgcggtgaagcacgagctcgcttacaaagg
tatgattgcacggctgaatctggagcagaaaggagaagatgtaagtttcatcaagcaagtggcaacagagctctttagcg
atggcaccacaaactggggtcgtattgccagcctgctgacatttggggcaatgctgtgcaaataccagaatgacagagga
catagcaagtatgtgaggttggtaggggaggagatctcgtcttatctacttacagagcagcgggactggatactcagaaa
caaagcatgggatggctttgtggagttttttcatgtcccggatacagaggcagctgtgagaaacacacttctaacaattg
gtagtgtggctacattaagtgcagcacttgcctattggatacggtga
>gnl|bcl2dbcds|Q90Z98_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|Q90Z98_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|Q9I9N3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Danio rerio GN=MCL-1 (length=768 residues).
atggctctgagtttggattttaggcgaacggccacgatgagcttcttcgcgcagggcgttcaaactccgacgctaaagac
gtgcgtcgaagacgaactggacggatacactgaggaggaggaggcgcctctgaagcggcttagaccgggtacaaacggcc
tgaaggggctgcagctggacggtcgatttgtttctgcgacagacggatctctaccgaccaccccagatccggaggagctc
gactacgccgaactggaacgcgatactcggcagctcttattggatttttaccgcacacacacgggaatgtgtccggtaga
ccgtaaactccatcacgccataccgacgatgaagcgagtggtcgacaatattctcgtgaagcaccagatcgcatacaaag
gaatgatccagcgtcttcagctggactctcagccggcctctctggacttcatcagatgtatagcaagcaccatgtttaaa
gatggcgtcactaactggggccgaatcgcgagtctggtggcgttcggggccgtggtttgctctcgattgaaggagctcca
gcaggatcagtgtgtggagagggtggctgagcagatctcctcatatctgacctcagaacagcaggactggatcctcaaaa
acaagagctggcatgggtttgtggagtttttccaccaggaggatgtagagtctgttgtccgtcatggtcttttggcgctg
gtcggatgtgccggtatcggtgccggtctggccttcctcatccggtga
© 1998-2018