Dataset for CDS BCL2L1 of organism Danio rerio

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|Q90Z98_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
>gnl|bcl2dbcds|Q90Z98_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Danio rerio GN=BCL2L1 (length=717 residues).
atgtcttactataaccgagaactggtggtattttttatcaaatataaactctcgcagaggaactacccctgcaaccacat
tggacttacagaagacacaaatcggactgatggggctgaagagaatggcgagggggcagcaggagcgacaactcttgtta
atggcaccatgaatagaacgaacgctagttccactgggaccccaccacaatcccctgcttcatccccccagcgtcaaaca
aatgggtctgggggtctagacgcagtgaaggaggcgctccgtgattctgccaacgagtttgagctgcgctattccagagc
attcaacgatctttcctcacagctccacatcacacccgccacagcgtaccagagcttcgagagcgtgatggatgaggtgt
ttcgcgacggcgtcaactggggccgaatcgtggggttgttcgcattcggaggggctctgtgcgtcgagtgtgtggagaag
gagatgagtccgcttgtgggacgcatcgcagaatggatgaccgtctacctagacaaccatattcaaccctggatccaaag
ccaaggaggatgggaacgctttgcagagatctttggaaaagatgcagcggcggaaagcaggaaatcgcaagaaagcttca
agaaatggttgtttgcaggaatgaccttgctcacgggtgtcgtcgttgggggactcattgcacagaaacgcctgtga
© 1998-2018