Dataset for CDS BCL2L10 of organism Cynoglossus semilaevis

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3P8W7K5_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Cynoglossus semilaevis GN=BCL2L10 (length=654 residues).
atgtgcaactcagcgtctccttccgccgtctctacgagctctgagcagtctgatatcgctgggaggaaaatgtcatgtgg
gctgtggaaagagaccctggctgtggcagaggactacctgtccctctgctgttcaagcccccggccagcccctccacctc
ccagcgagtcagccgctgccatgagacacctggcccaggacatggagaagcagcaccaagctcgcttccagacgttgtct
cagtctttcctgaggcaatgtggctctgagccctgtgtgtgtcttaggaaggttatggaagagctggtaggagacggaca
cttgaactgggggagagttgtttccattttcacctttactggggttctggccaaacagctgttggtccagaagggtttaa
agccggggcaggaacccgaggcagggcaggaactgggaccggagcctggaacctgcagggaactggcagagaccattgct
gattatctgggagaagagaagaaagcgtggcttttggagaatggtggatgggaggggttctgtgagttctctcacagtgc
cagagagctgagccaggactcgtccatgaagaccgctctgtttgctgctgctagtgttggccttgctggactcaccttcc
tcctggtgcgctga
© 1998-2019