Dataset for CDS BCL2L1 of organism Cynoglossus semilaevis

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A3P8UWG7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=BCL2L1 (length=708 residues).
actttgacctttaatattaacagaaaactggtggtcgactacatacagtataaactttcccagaggaactttcccgtcca
ccacctgggactcggtgattctccaaacaggactgatggggaagaggcagggttgggcgcagagcagcggacaagtacgc
acgccaacgggactgtaaacggcacaagttctgggacgccgcctgcatctccactgcggcagcagcattcggcgtcggat
acaagtctggactccattaaagaggctctgcgggactcggccaacgagtttgaactgcgatacgcgcgggccttcagcga
tctgcaccagcagctgcacatcacaccagccactgcctaccaaagtttcgagaatgtgatggacgaagtgttccgggacg
gtgtcaattggggtcgcatcatagggctcttcgccttcggcggggcgctgagtgtcgagtgcgtggagaaagagatgagt
cagctggtggccaggattgcggattggatgacagtctatcttgacaaccacatccagccatggatcgaaacccaaggtgg
atgggagcattttgcggaactctttggtcaggatgcagcagcggagagccggaggtcacaggagagttttaagaaatggt
tgctggctgggatgacgctggtgacaggcgtggtggtgggctccctgattgcccagaaacgtctctga
>gnl|bcl2dbcds|A0A3P8VMA1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cynoglossus semilaevis GN=BCL2L1 (length=645 residues).
atgtcgtgcagtaacagagaattggttaagttctttttaggttataagctttctcagaggaactacccagaatctcttct
gatgttgaggattgggggagaacagcgtgaaggtgaggaggtcaccacagcgtccagtaatggcgttcctcagactcctt
cagctgtgctgcagcactgcagtggtgcagaggctgtaaaggctgctctcaaggactcagctgacgagtttgaacttcgc
ttcacacaagcctttcgtaaccttttcttaaagctggacctcactccggacacagtctaccacagttttaagagcgtgat
ggatgaggtcttcagagacggagtcaactggggacgcatagtcggcctgtttactttcggaggagtactgtgtgtggaat
gtgtgcagaggaatatgagtgagttagttccccgcattgcagactggatgaccatgtacttggatgaatacattgatcca
tggatccagagccaaggaggctgggaccgttttgctgagatttttggcacagactgtattccaagaacgaggagttgtcg
ggacacagtgagaagatggctgctagtgggagcaggcctgcttgcagcagtgttgattggtgttctgatcactaaaaagc
attga
© 1998-2019