Dataset for CDS BCL2L1 of organism Ctenopharyngodon idella

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A345BSW9_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Ctenopharyngodon idella GN=BCL2L1 (length=627 residues).
atgtcttactataacagagaactagtggtattttttattaaatataaactctcgcagaggaactacccctgcaaccacat
tgggcttacagaagacacaaatcggactgatggggccgaagagaatggtgagggggcggcaggaacgacgaccctcgtta
acggctccatgaacagaaccccaccacaatcccccgctacatccccccagcatcagacaaacgggagtgggggtctggac
gcggtgaaggaagcactacgcgattctgccaatgagtttgagctgcgttattcccgagcgttcaacgacctttcctcaca
gctccacatcacacctgccacggcataccagagctttgagagcgtgatggatgaggtgttccgcgacggcgtcaactggg
gccgcatcgtgggactgtttgccttcggaggggctctgtgcgtcgagtgtgtggagaaggagatgagcccattagtggga
cgcattgcagaatggatgaccgtctacctggacaaccacattcagccctggatccagagccaaggaggatgggtgagtgg
aaaattacttgcatttctttcctaccttgttccctttcttcagtttaatcacaaagagcctttgtaa
© 1998-2019