Dataset for CDS Unclassified of organism Crassostrea gigas

[Download (right click)]

4 sequence(s)

>gnl|bcl2dbcds|K1PS96_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=2400 residues).
atgcccccaccttcagagcaagaaatcaaagctgaagttcgtaaaatcttggaacaattcctaaagaaacaactgctgaa
caataatgaagaggaaagtgcaatacccactggatttcagagagtatctgtggaggacgtggttgaaacagatgggccag
gtagcacaagcacatctcgtgaaggatccaggtactcttccaaaaccagctgtgccagatgccgtagcgaggccagccag
tctattcccacaagttctattcgatctctcactgacaatacaattgatttccctttcattgatgaggatgaaaatgaggt
tgatcattctgataaagaccactcagaaaggtctaagagtctaccctcaaatattctatcgtctgtcaaaattcaggata
aaaactctcttgcattatcaaaatcacttagtccaaccaaactcagggaagtcatcaacaatggccctcctctaaataaa
gcatctgaaaaaggagaccgagaacttagtctatatagcagtgaagattttctgcagacagggtctgggctcaaggacat
agaggagataggtatatcaagagggcgacagagactgaagtctggaacagaatctgggacagatgatactgactacgagg
aagaagtcatctccccaaatcgaaagaagaaatctatctttacacgactgaaggaacgtatgaacaggagtttgagtcgt
ggtcgaatcaaagaaaatgaagaaaataaaagaacaaggtcccggtcagaaggttcagtaataataaaaagacggaaacc
tagaaaaaagaaagacattggttccagtgtggataaggtgagtgatgttgttcaaaatgttcacacccacaaacatggcc
acgttgaacaacatcactacagcaatggaaataaatcgggaatgttgatggagagtgaagtgtgggagtccacagatgtg
actggagaatctgaacacaagcatgaagagaggcattccaacatcagggagagtaaggaacagccgtccgatggtgagaa
tggaatcatgagacggctgaagaaaatgacctccttcaagaagtccaagaaaaataaatctgattccccatcctcgaaag
catcaaaatcagacgaggttgattttgaccacaagaggccaaagtcccccaaaacagactttggtcgttctgtgtcttct
ggtcaggggtaccaagaaagggtacatatgaatggagaccactccagacaaaccaccactaccactgtggtaacggggac
acaaatacaaggttgtaccgatgagaaccttccagagggccccattaaaggagaagtgatggatcttgccaagaagaaca
aatcgttcgtgctggactttgagacttgtgagaggcagcaaaggagactccttcctgatggaagctttgacacgaccgtc
caacaacatgtcaaggtcaaacactttgatgaaggtcatgatattgaagttgatggcactgaagaccaagcaatgtgtcc
aagacatgcagcatcaggacagcctaaccctgaaaaagaccgcctgtacactgcagttgcagagaagttggcacacattg
gggaccactatatggctaccagtccactgtctgatagtaccagtagctccgtggatcacactgcgactaggagagtcagt
gccagaaccccaaacctacctggagtggatgaaagagacagtgacggattgacacagctagaaagacagctaagagacaa
gtttagagaagtgggggatacattttctcttgacatttctcccgattctgtgaaagatgctgccatggaaattgccaagc
aggcaacctaccagaagttccaggaagtggtcgacaacaagatcggccccggcaacagctgggaccagattgccgccgtg
ttctacctgaccaagaaagctgtcactcttgcaggggtgggcggggccgttgcactgcaggtgaaagatcttgcggcaga
atacgtggccgataagtttgccacatggattgtggatcagggaggatggggtaagcacttgtcagtcttggcgcctccag
aacttaacgagaacattaccgtcaagatcaacttctccaagtgctacaacgtacggggaacacaacagattcttcatatg
gagcaaggtcccagaagtaaaatcctggaagtgtttaggataaacacctatagcaactccccagggactaaccgaaactg
tctctggatgggagggggtttcactatagacaatcacactaccgttaccttctcatccagtcgaggacggccaattcctg
attctgtatgtcgaagtacatccttcaccgactttccagacgaatatctccatatacgattacaagaactgtcaaggtga
>gnl|bcl2dbcds|K1PWI6_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=441 residues).
atggaccgtttgggaacgagatatattgtgactgactacttgaaccatcgtctgtcgaagaatgggcacacatggactca
ctgcccgcccctcctggatccccccctcaagatccacaccacaatgcgggacaagggggacgaattcgaggaactataca
aggtccagttccaggacttggtggaccagctgcacgtgacccacgatacgtgttatcccatgtttaaggcggtggttgag
gaactgttccaagggggcacgaattggggtcgggtggtggcgctgttcgcgttcagtggctccctggccacgcgctgtgt
ggagaaagggatggcgggactagtggactctatcgtggactgggtgacacagttcatagaacaggacctacgtcagtgga
tagaccagcacgggggatgggtaggttatcatcgtgaatag
>gnl|bcl2dbcds|K1QHH5_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=684 residues).
atggctaccgaaatagaaaacataaagcattccagtggaaactatctgaaaggaaatctattcagtgaaattaaccggca
gcttggtattcttcctggatttgctggattagggcaagatatgacaaaattagaccaagaaacacagactcctggcagta
ccacaccgatggataaagtccgacagacggcagaggtgatagcttctgatgttattgccacatttgaagatgattctacc
aaaactccacaaaacagatactgtaaaacaatgagaagaactgtaaaagaaatgtccgaccgacataatatcgcttttaa
atctatggtgcagaaattgaatgtgaatgacactaatgccttctcaacattcgtatcagttgcggatgagatttttgagg
acgggacaattaattgggggagaatcgttgctgtctacacttttgcttcacgattggcagcccattgtaaaaaacataac
cccgaatcagaagaaaggatagcactctatgcaggaaaatatgtggcaagcaaattggggaaatggatcttggataatgg
gggatgggatgcgttttctgattattttcccgagcaaggagcaacagaggacaagctttggaaaggcctgatgttcactg
cagtaggtctcgtgacattgggaaccatggttgctaggagttga
>gnl|bcl2dbcds|K1R9D6_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Crassostrea gigas (length=618 residues).
atggctaccgaattagaaaacataaagcattccaatggaacctatctgaaaggaaatctattcagtgaaattaaccggca
gcttggtattcttcctggatttgctggattagggcaagatatgacaaaattagaccaagaaacacagactcctggcagta
ccacaccgatggataaagttcgacagacggctgaggtgatagcttctgatgttattgccacatttgaagatgattctacc
aaaactccacaaaacagatactgtaaaacaatgagaagaactgtaaaagaaatgtccgatcgacataatttcgcttttaa
atctatggtgcagaaattgaatgtgaatgacactaatgccttctcaacatttgtatcagtagcggatgagatttttgagg
acgggacaattaattggggtagaatcgttgctgtctacactttcgcttcacgattggcagccgattgtaaaaaacataac
cccgaatcagaagaaaggatagcactctatgcaggaaaatatgtggcaagcaaattggggaaatggatcttggataatgg
gggatgggttagtattgatttgaatgtcaactgtaacttgaagagatcattagtataa
© 1998-2018