Dataset for CDS Unclassified of organism Colobus angolensis palliatus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K5HYN7_uncBCL2A1-01 Putative BCL2-related protein A1 gene OS=[Eukaryota] Colobus angolensis palliatus (length=213 residues).
atggcacgatctcggctcactgcaacctctgtctcccaggttcaggaaaatggctttgtaaagaagcttgagcctaaatc
tggctggatgacttttctagaaattacaggaaagatctcaatactgttgaccagaaaggacactccatattgtgaaactg
gcttaatttttctgactcttaagaaaacgattgccaacacatactttactttt
© 1998-2018