Dataset for CDS BCL-2 of organism Cercocebus atys

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K5NZS5_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Cercocebus atys GN=BCL-2 (length=720 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgcgggggatgtgggcgcggcgacccctggggtcgcccccgcaccgggcatcttctcctcccagcccg
ggcacacgccccatcccgccgcgtcccgggacccggtcgccaggacctcgccgctgccgaccccggctgcccccgccgcc
gccgcggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggtgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacggtgg
tggaggagctcttcagggacggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcacctgcacac
ctggatccaggataacggaggctgggacgcctttgtggaactgtacggccccagcatgcggcctctgtttgatttctcct
ggctgtctctgaagactctgctcagtttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaagtga
© 1998-2018