Dataset for CDS BCL2L1 of organism Cavia porcellus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A286Y5D6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Cavia porcellus GN=BCL2L1 (length=702 residues).
atgtctcaaagcaactgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaaggcccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacctaactgatagtcccacggtgaatggggccactggccacagcagtagtttggatgcccgggaggtg
atccccatggcagcagtgaagcaagctcttagggaggcgggcgatgagtttgaacttcggtaccggcgagcattcagcga
cttaacatctcagctccacatcaccccggggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcattgtgcgtggagagcgtagacaaggagatgcag
gtattggtgaggcggatcgcaagctggatggctacttacctgaatgaccacctagaaccttggatccaggacaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tgctgacgggcgtgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
© 1998-2018