Dataset for CDS BCL-2-like of organism Capra hircus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A076FU27_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Capra hircus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgcgg
ctacgagtgggatgccagagccgcgggcgccgcgccccccggggccgcccccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgcca
cctgtggtccacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
ccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatatgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgc
ctttgtggagctgtacggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|A0A076FZV9_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Capra hircus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggcacaggctacgataaccgcgagatcgtgatgaagtacatccactacaagctgtcgcagcgcgg
ctacgagtgggatgccggagccgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgcca
cctgtggtccacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
ccagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacgcctggatccaggacaacggaggctgggacgc
ctttgtggagctgtacggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
© 1998-2018