Dataset for CDS BCL2L1 of organism Capra hircus

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|A0A452E1B1_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgggaactagtggttgactttctctcttacaagtttttccagaaaggatacagctggagtcagtt
tagtgatatggaagagaacagaactgagaccctagaagggacagaatcagatatggaaacccccagcgccatcagtggca
acccatcctggcacctggcagatagctctgtggtgaatggagccactggtcacagcagaagcttggacgctgggaaaatg
atccccacggcagtggtgaagcaagccctgagggaggcaagcaatgagtgtgaattgaggtaccaacagacattcagcga
cctgacgtcccagctccacatcaccccagggacaacatatcagagctttgaacaggtaataaatgaactcttccaggatg
gggtgaactggtgtcgcaatgtggcctttttctccttcggtggggcactatgcatgaaaagcatagtcaaggagatgcag
gtattggtaagtcaggtcacgacttggatggccacttacctaaataaccacctagagccttggatccaggagaatggcga
ctgggacatttttgtggaactctacgaaaacaatacagcaaccgagagccaaaagggccaagagcacttcaaccgctggt
ccctgacggacgtgactgtggctggtatggctctgctgggcttgctcttcaacacataa
>gnl|bcl2dbcds|A0A452FIG6_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=699 residues).
atgtctcagagcaaccgagagctggtggttgactttctctcttacaagctttcccagaaaggattcagctggagcctcag
aagggacaaaatcagatatggaaaccccaatgccgtcaatgccaacccatcttggcacctggcgcatagccctgcggtga
atggagccactggccacacagaagaaagtggtcctgtggcaacagcacagcaagccccgagggaggcaggcagcgagttt
gaactgaggcaccaacagacggtcagcgacctgacgtcccagctccacaccaccccagggacagcatatcagagctttga
acaggtaatgtatgagctcttctgggacggggtgaactgggatcacactgtggcctttttctccttcaggggggcactat
gcatggaaagcgtagacaaggagatgcaggtattggtgagtcaggtcatgacttggatggccagccagctaaatgaccac
ctagagccttggatccaggagaatggcggctgggacacttctgtggaattctgtgaaaacaatacagcaaccgagagcca
aaagggccaggagcgcttcaactgctggtccctgacggctgtgactttggctgggggatcaggactcagcaggaaggcag
ctgtctctaaagataccccttggctcaccttcccctctccccatgctcaagcctactga
>gnl|bcl2dbcds|A0A452FIG6_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=723 residues).
atgtctcagagcaaccgagagctggtggttgactttctctcttacaagctttcccagaaaggattcagctggagcctcag
aagggacaaaatcagatatggaaaccccaatgccgtcaatgccaacccatcttggcacctggcgcatagccctgcggtga
atggagccactggccacacagaagaaagtggtcctgtggcaacagcacagcaagccccgagggaggcaggcagcgagttt
gaactgaggcaccaacagacggtcagcgacctgacgtcccagctccacaccaccccagggacagcatatcagagctttga
acaggtaatgtatgagctcttctgggacggggtgaactgggatcacactgtggcctttttctccttcaggggggcactat
gcatggaaagcgtagacaaggagatgcaggtattggtgagtcaggtcatgacttggatggccagccagctaaatgaccac
ctagagccttggatccaggagaatggcggctgggacacttctgtggaattctgtgaaaacaatacagcaaccgagagcca
aaagggccaggagcgcttcaactgctggtccctgacggctgtgactttggctgggctcgctcttcaactcatagtgactg
ttcctttcattacagtcattcatgttttgcacaagcttgtgttcccttccttttgttacagctatagagaccttacaatt
taa
>gnl|bcl2dbcds|A0A452FWV3_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Capra hircus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acccatcttggcacctggcggatagccctgcggtgaatggagccaccggccacagcagaagcttggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacattaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggctacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacgtttgtggaactctatgggaacaacgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
© 1998-2019