Dataset for CDS Unclassified of organism Canis lupus familiaris

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|J9PBM3_uncBCL2L10-01 Putative BCL2-like 10 gene OS=[Eukaryota] Canis lupus familiaris (length=126 residues).
ggggaccccccggagccgggcgagtgggaggccagggtcggccaggcccgccggcacctggtggccctcctctgccgccg
gctcacaggccagcaccgcgcctggctggaggcgcacgacggctgg
© 1998-2018