Dataset for CDS BCL-2-like of organism Canis lupus familiaris

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|E2RS00_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2A1 (length=525 residues).
atgacggactgcgagtttggctacacgctggcgctggcccaggactacgtgaggcacgtcctgcagatcccgcagcccgg
cccggcccccagcagagcgtccagggtgctccaggacgtggccttctccgtccaggggcaggtggaaaagaacctgaagc
cgtgcttggacagttttgacgtggtgtctgtcgacacggccagaaccatattcaatcaggtgatggagaaggaatttgaa
gacggcgtcattaactggggaaggatcgtgaccgtttttgcctttgaaggaattctcaccaagaaactcctcgagcagcg
aatttcctcggatgtggatgccgagaaggtttcctacttcgtggcagagttcatcacgagaaacatgagagactggataa
gacaaaacggaggctgggaaaacggctttgtgaagaagttcgaacccaagtctggatggctgacttttctggaagttctg
ggaacagtgtgtgaaatgtggtcacacctaaagcaatactactga
>gnl|bcl2dbcds|J9NXG3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=654 residues).
atgaagtacatccactacaagctgtcgcagaggggctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggc
cgcccccgcgccgggcatctccgcctcgcagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncagccccgtgccacctgtggtccacctgaccctgcgccaggccggc
gacgacttctcccgccgctaccggcgtttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacg
ctttgccacggtggtggaggagctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtgggg
tcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaac
cggcatctgcacacctggatccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctct
gtttgacttctcctggctgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatc
tgggccataagtga
>gnl|bcl2dbcds|J9NXG3_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=480 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcncagcc
ccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccgctaccggcgtttcgccgagatg
tccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggatggggt
gaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccc
tggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatccaggacaacggaggctgg
>gnl|bcl2dbcds|J9PBC4_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|J9PBC4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1404 residues).
atgttcggcctcaagagaaacgcagtaatcggactcaacctctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggaaggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagttggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
ggcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatggaggggtgtggggggagtgg
tccaccccctctgaccttaagggtgagagcaggaaggaatgctgcccttcctgggccgctgaggctggaaggtggggggc
tgacctcagcctccagaccgtggctcagtggctcagtcccctcctgtcagcctgcaggaactcctcagctcctccctcct
ccccactagggattgtttacaggacagcttgggccacacagcacacgctcttcctgaagatgattctgatctggtttgcc
ctcctccctcccagaggaccccgatggccgagggaggcatgggtgacaacatgtgggacacccactccaaggagtggacc
agaagccccatgggagttcctttccctacctgccacccagctctttctcccatttttaacgaagctccttctggaacact
caggcatctctgccggactcaaacactttgtagccaagagataa
>gnl|bcl2dbcds|Q45T69_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcagccccagacacacgggctctagtggcagactttgtaggctataagctgaggcagaagggtta
tgtttgtggagctggccctggagagggcccagcagctgatccactgcaccaagccatgcgggcagctggagatgagtttg
agacccgcttccggcgcaccttctctgatttggcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacc
caggtctctgacgaactcttccaagggggccccaactggggccgtcttgtggccttctttgtctttggagctgcactgtg
tgctgagagtgtcaacaaagagatggagccacttgtgggacaagtgcaagagtggatggtggcctacctggagacacggc
tggccgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcctcagtgaggacagtgctgacgggggccgtggcactgggggccctggtcaccgtagg
ggccttttttgcgagcaagtga
>gnl|bcl2dbcds|Q6R755_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctggcatcttctccttccagcctg
agagcaacccaacgcccgctgtgcaccgggacatggctgccaggacatcgccactaaggcccatagtcgccaccactggg
cctacccttagccccgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgatttctcctggctgtctc
tgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|Q75SV7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=720 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgccgac
gccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacac
ctggatccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcct
ggctgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|Q76LT7_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggactgaatcagagatggagacccccagtgccatcaatggca
acccatcctggcacttggcagacagccctgcggtgaatggagccactggccacagcagcagcttggatgcccgggaggtg
atccccatggcagcggtgaaacaagcgctgagggaggctggggatgagtttgaactgaggtaccggcgggcattcagtga
cctgacatcccagcttcacatcaccccagggacagcatatcagagctttgagcaggtagtgaatgaactcttccgggatg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggagagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggatacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacaggcatgactgtggctggcgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|Q8HYS5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Canis lupus familiaris GN=MCL-1 (length=1053 residues).
atgtttggcctcaagagaaacgcagtaatccggactcaactctactgtgggggggccgggctgggggccggcagcggcgg
cgcctcctcttcgggagggcggcttttggcttcggggagggaggccacgaccagacgggagggagggggaggggaagccg
gtgcggtgattggcggaagcgccggcgcaagtcccccgaccactctggcgccggacgcccggagggtcgcgcggccctca
cccattggcgctgagggccccaacgtcagcgcgacccccccgaggctgctgctgctcgcgcccccctgccgcgcgtcgcc
gcctgaagagatggaaggcccggccgccgacgccatcatgtcgcccgaagaggagctagacgggtacgagccggaacctt
tggggaagcggccggcggtcctgcctctgctggagctggtgggggaggccagcagtggccccggcatggacggctcgcta
ccctcgacgccacccccggcggaggaggaggaagatgagttgtaccggcagtccctggagattatctctcggtaccttcg
ggaacaggccacaggcgccaaggacgcgaaaccactgggcgggtctcgggcggccagccggaaggcgttagagaccctcc
agcgagtcggggacggggtacagcgcaaccacgagacagccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatcgttgtctcgagtgattgtccatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcctttggtgcctttgtggccaaacacttgaagagtataaaccaagaaagctgcatcgaaccattagcagaaagca
tcacagatgttctcgtaaggacgaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcata
tctaataagatag
© 1998-2018