Dataset for CDS BCL-2 of organism Canis lupus familiaris

[Download (right click)] [Alignment] [Repertoires]

4 sequence(s)

>gnl|bcl2dbcds|J9NXG3_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=480 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatctccgcctcgcncagcc
ccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccgctaccggcgtttcgccgagatg
tccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagctcttcagggatggggt
gaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccc
tggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatccaggacaacggaggctgg
>gnl|bcl2dbcds|J9NXG3_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=654 residues).
atgaagtacatccactacaagctgtcgcagaggggctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggc
cgcccccgcgccgggcatctccgcctcgcagnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnncagccccgtgccacctgtggtccacctgaccctgcgccaggccggc
gacgacttctcccgccgctaccggcgtttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacg
ctttgccacggtggtggaggagctcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtgggg
tcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaac
cggcatctgcacacctggatccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctct
gtttgacttctcctggctgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatc
tgggccataagtga
>gnl|bcl2dbcds|Q6R755_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=711 residues).
atggcgcaagccgggagaacagggtatgataaccgggagatcgtgatgaagtacatacattataagctgtcacagagggg
ctacgagtgggatgtgggagatgtggacgccgcgcccctgggcgccgcccccacccctggcatcttctccttccagcctg
agagcaacccaacgcccgctgtgcaccgggacatggctgccaggacatcgccactaaggcccatagtcgccaccactggg
cctacccttagccccgtgccacctgtggtccacctgaccctccgccgggctggggatgacttctcccgtcgctaccgtcg
cgacttcgcggagatgtccagtcagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtggtggaggagc
tcttcagggatggggtgaactgggggaggatcgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaac
cgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacacctggatcca
ggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgatttctcctggctgtctc
tgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|Q75SV7_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Canis lupus familiaris GN=BCL-2 (length=720 residues).
atggcgcacgctgggcgaacagggtacgataaccgggagatagtgatgaagtacatccactacaagctgtcgcagagggg
ctacgagtgggacgcgggagaggcgggcgccgcgcccccgggggccgcccccgcgccgggcatcttctcctcgcagcccg
gccgcgcccccgcgcccgccaggacctcgccgcccccgccccccgccgcccccgctgccgccgccgccgccgccgccgac
gccgcgggccccgcgcccagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgacgacttctcccgccg
ctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgaggggacgctttgccacggtgg
tggaggagctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggag
agcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgactgagtacctgaaccggcatctgcacac
ctggatccaggacaacggaggctgggatgcctttgtggaactgtacggccccaccatgcagcctctgtttgacttctcct
ggctgtctctgaaggcgctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctatctgggccataagtga
© 1998-2018