Dataset for CDS Unclassified of organism Callithrix jacchus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|F7IT36_uncBCL2L1-03 Putative BCL2-like 1 gene OS=[Eukaryota] Callithrix jacchus (length=444 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggcaaccca
tcctggcacctggcggacagcccagtgctttgaacaggtagtgaacgaactcttccgggatggggtaaactggggtcgca
ttgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
gcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtgga
actctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactg
tggccggcgtggttctgctgggctcactctttagtcggaaatga
© 1998-2019