Dataset for CDS BCL-2-like of organism Callithrix jacchus

[Download (right click)] [Alignment] [Repertoires]

12 sequence(s)

>gnl|bcl2dbcds|A0A2R8M4C0_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L2 (length=645 residues).
cttctggttctctgtccatatattaatgccagtctttcatccttgcctcttatagctgcccggatggcgaccccagcctc
cgccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaaaggttatgtctgtggaactggcc
ccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgaattcgagacccgcttccggcgc
accttctctgatctggcggctcagctgcatgtgaccccaggttcagcccaacaacgcttcacccaggtctccgatgaact
tttccaagggggtcccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtgtcaaca
aggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggccgactggatccac
agcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcggcgtctgcgggaggggaa
ctgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtaggggccttttttgctagca
agtga
>gnl|bcl2dbcds|A0A2R8M4C0_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L2 (length=1041 residues).
atggcgaccccagcctccgccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaaaggtta
tgtctgtggaactggccccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgaattcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggttcagcccaacaacgcttcacc
caggtctccgatgaacttttccaagggggtcccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggaactacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcagatcaagattgactttaaggctttcatttattcatctctgactcaggtgatcccaaaacgaaccaacagaccaggca
tcagcacaacagaccggggttttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgctctcgattc
tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttacta
a
>gnl|bcl2dbcds|A0A2R8MY14_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Callithrix jacchus GN=BCL-2 (length=723 residues).
atggcgcacgctgggagaacagggtacgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagatgtgggcgccgcgcccccaggggccgcccccgcggagggcatcttctcttcccagcccg
ggcacacgcccggtcccgccgcgccccgggacccggtcgccaggacctcgccgccgccgcccccagccgcccccgccgcc
gccgccacggggcctacgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggcgacgacttctcccg
ccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacgg
tggtggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtg
gagagcgtcaaccgggagatgtcgcccctggtggacaacatcgccctgtggatgaccgagtacctgaaccggcacctgca
cacctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagcatgcggcctctgtttgatttct
cctggctgtctctgaagactctgctcagcttggtcctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
tga
>gnl|bcl2dbcds|F7CT87_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L10 (length=681 residues).
atggctgacccgctgcggcagcgcaccgagcagctggtgacggactacctggagtactgctcccgggagcctggcacccc
cgagtcgccgccgtccaccgccgaggccgctgtgctgcgcgccgtggccgccagtgtgcggaaactctaccggtctttct
tctccgcctacctcggctaccccgggaaccgcgtcgagctggtggcgaggatggcggaggccctgctctccgacagtccc
ggccccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggggccgctggtgaccgcccg
gtggaagaagtggggcttccagtctcggctgaaggagccggaaggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagttcgcggctcgtggggcagcaccgtgcctggctggaggctcagggcggctgggtgagcaaggagggggacacg
gggcgggataggcacctgggaaccgcccgcccacgatggcttttgttacttcttcaggacctcctccttgctggcattat
ggagaaaagtgctggtccaggttttcctgtcatggttgttaacagcagtattcatctacttctggacacgataatgagga
gttttaaaagttttagcccacttctacctgcccaactgtga
>gnl|bcl2dbcds|F7GTF7_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Callithrix jacchus GN=MCL-1 (length=594 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggcgctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcgggtgttgctgg
agtaggagctgggttggcatatctaataagatag
>gnl|bcl2dbcds|F7GTF7_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Callithrix jacchus GN=MCL-1 (length=813 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacagagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgactggcggaagcgccggcgctagccccccggccgccctcacgcctgacgcccgaagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgccggaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggagcctgctaatggctccagtacggacgggtcacta
ccgtcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcgggtgttgctggagtaggagctgggttggcatatctaataa
gatagccttggaa
>gnl|bcl2dbcds|F7GTF7_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Callithrix jacchus GN=MCL-1 (length=1053 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacagagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgactggcggaagcgccggcgctagccccccggccgccctcacgcctgacgcccgaagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gctggaggagatggaagccccggccgccgacgccatcatgtcgccggaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcctctgctggagttggtcggggagcctgctaatggctccagtacggacgggtcacta
ccgtcgacgccgccgccagcagaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcgggtgttgctggagtaggagctgggttggcata
tctaataagatag
>gnl|bcl2dbcds|F7IT34_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagcccagtggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|F7IT34_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L1 (length=444 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggcaaccca
tcctggcacctggcggacagcccagtgctttgaacaggtagtgaacgaactcttccgggatggggtaaactggggtcgca
ttgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatc
gcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtgga
actctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactg
tggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|F7IT34_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagcccagtggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcaggcgacgagtttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|U3DBA0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2A1 (length=528 residues).
atgacagactctgaatttggatatattcacaatctaactcaggactatctgcagtacgtcctgcagataccacagtctgg
aatgggtccgagcaaaacgtctagagtgctacaacaggttgcattctcagtccaaaaagaagtggaaaagagtctgaagt
catgcttggacaatgttgatattgcgtccatagataatgccagaacgatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatctcacattttgttgctgagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgcgaaatgctatctctcttgaagcaatactgttga
>gnl|bcl2dbcds|U3DBA0_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2A1 (length=489 residues).
atgacagactctgaatttggatatattcacaatctaactcaggactatctgcagtacgtcctgcagataccacagtctgg
aatgggtccgagcaaaacgtctagagtgctacaacaggttgcattctcagtccaaaaagaagtggaaaagagtctgaagt
catgcttggacaatgttgatattgcgtccatagataatgccagaacgatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatctcacattttgttgctgagttcataatgaataacacaggagaatgga
taagacaaaacggaggctgggggaaatggcacagtctcatgcttatgctagtatcagtggcccagaagaagaggaaaatg
gctttgtaa
© 1998-2018