Dataset for CDS BCL2L2 of organism Callithrix jacchus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A2R8M4C0_BCL2L2-04 BCL2-like 2 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L2 (length=645 residues).
cttctggttctctgtccatatattaatgccagtctttcatccttgcctcttatagctgcccggatggcgaccccagcctc
cgccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaaaggttatgtctgtggaactggcc
ccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgaattcgagacccgcttccggcgc
accttctctgatctggcggctcagctgcatgtgaccccaggttcagcccaacaacgcttcacccaggtctccgatgaact
tttccaagggggtcccaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtgtcaaca
aggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggccgactggatccac
agcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcggcgtctgcgggaggggaa
ctgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtaggggccttttttgctagca
agtga
>gnl|bcl2dbcds|A0A2R8M4C0_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Callithrix jacchus GN=BCL2L2 (length=1041 residues).
atggcgaccccagcctccgccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaaaggtta
tgtctgtggaactggccccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgaattcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggttcagcccaacaacgcttcacc
caggtctccgatgaacttttccaagggggtcccaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaggaactacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcagatcaagattgactttaaggctttcatttattcatctctgactcaggtgatcccaaaacgaaccaacagaccaggca
tcagcacaacagaccggggttttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgctctcgattc
tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttacta
a
© 1998-2018