Dataset for CDS BCL-2-like of organism Bufo japonicus formosus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|J7H260_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bufo japonicus formosus GN=MCL-1 (length=639 residues).
atgggcggctctctgccctccccgcagtccgagctggacgaggacgaggattacatggacgtacagtcggactcccgggg
ctccacctcccctccgctcacccccacctgctccccggaccccctgcacacggaaacccgcgccctgctgcacaccttct
tcagggaatgggccggagacgcgaagcaggaggacggcgacagcccgaaggcgctgcccaccatgcgcaggctggggggc
gacatcaatgagaagcaccgaatggcctttcagggcatgttgcagaagttatctatacaacgtccagaagatatccagaa
gctctccgaggtcccctctatggtcttcagcgatggggttaccaattggggccgtatcgtcaccgtgataagctttggtg
cgtttgtggctaaacatttgaaaagcatccacatggagaactgcgttggaatcctagcggacagcttcacagactatctt
atgacccagaagaaagaatggatcgtagaacacaatggctgggatggctgtgtcgaattctttcacgtcgaggactatga
gagtggactaaaaacagtcttgatggccttcgctggtgtggctggtcttggagcaagcctggcgtacatgatccggtga
© 1998-2018