Dataset for CDS Unclassified of organism Bos taurus

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|A1L569_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Bos taurus (length=729 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
cagacccaagtcctggccccagccccggccccagccccaggcatggcatcaaccctggcccaggccctagccccaggcct
ggctcaggctgtgaccccgcctgcccccaggaccaaccagaccggggaagggacactgacagaggccctgctgcagctgc
agtttgataccgatgaagacctgggggctctgcttggcaacaacactgaccctgccgtgttcacagacctggcatctgtc
gacaactctgagtttcagcagttgctgaaccagggtgtacccatgggcccccacacagctgagcccatgctgatggagta
ccctgaggctataactcgcctggtgacagggtcccaaaggccccctgacccagctcccactcccctggggccccctgggc
tcaccaatggcctcctctcgggggatgaagacttctcctccatcgcggatgtggacttctcagcccttctgagtcagatc
agctcctaa
>gnl|bcl2dbcds|Q05KI9_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Bos taurus (length=513 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggacacttttgtggaactctacggga
acaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtggctggtgtg
gttctgctgggctcgctcttcagtcggaaatga
© 1998-2018