Dataset for CDS MCL-1 of organism Bos taurus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A5PJR2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos taurus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccagcagaggaggaggaggacgagttatatcggcagtccctggagataatctctcagtacctccg
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|F1MQX4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos taurus GN=MCL-1 (length=573 residues).
ggaatgttgccaatattttcagaggaggaggaggacgagttatattggcagtccctggagattatctctcggtacctccg
ggagcaggcaaccggcgccaaggatgtgaagcccctgggcgggtctggggccaccagccggaaggcgttggagaccctgc
accgagtcggggatggggtgcagcacaaccacgagacggctttccaaggcatgcttcagaaactggacatcaaaaacgaa
gacgatgttaaatctttgtctcgagtgatggttcatgttttcagtgacagagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacactttaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaagaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
© 1998-2019