Dataset for CDS BCL-2-like of organism Bos taurus

[Download (right click)] [Alignment] [Repertoires]

10 sequence(s)

>gnl|bcl2dbcds|A5PJR2_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos taurus GN=MCL-1 (length=1053 residues).
atgttcggcctcaagagaaacgcagtaatcggactaaacctctattgtgggggagccggattaggacagggcagcggcgc
ctcctctccgggggggcggcttttggctgcggggaaggaggccacggcgcggcgagaggtagggggaggggaagccggca
cggtgattggcggaagcgccggcccgagccccccggccactcttgcgcccgacgcccggagggtcgcgcggccctcgccc
attggcgccgagggccccgacgtcaccgcgacccccaccagactgctgttcttcgcgcccacacgcctcgcgtcgccgcc
tgaagagatggaatccccgatctccgacgccatcatgtcgcccgaagaggagctggacgggtgcgagccagaccctctcg
ggaagcggcctgccgtccggcctttacctttgttggtcggagaagccagtaacaacagtccaggctcggacggctcgctg
ccctcgacgccgcccccagcagaggaggaggaggacgagttatatcggcagtccctggagataatctctcagtacctccg
ggagcaggcaaccggcgccaaggacgcgaagcccctgggcgggtctgggaccacaagccggaaggcgttggagaccctgc
gccgagtcggggatggggtgcagcgcaaccacgagacggctttccaaggcatgcttcggaaactggacatcaaaaatgaa
gacgatgtcaaatctttgtctcgagtgatggttcatgttttcagtgacggagtaacaaactggggcaggattgtgactct
tatttcttttggtgcctttgtggccaaacacttgaagagtataaatcaagaaagctgcatcgaaccactagcagaaagca
tcacagatgttctcgtaaggtcaaaacgagactggatagtcaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccggagtaggagctggtttggcata
tctaataagatag
>gnl|bcl2dbcds|E1B9B3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos taurus GN=BCL2L10 (length=633 residues).
ggagccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctgcgcccgggagccggg
cactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaagcaaatcgaa
acgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcgacgaa
gaccctggccccagctggggccgcgtggcctcactcgtaaccttcgcggggtcgctgctggagaggccaccgcagacgac
ccgacggcaggagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttct
gcgaaaggcaccgcgcctggctgatgactaacggcggctgggatggattttgtctcttcttcagccactcattccagcca
tcttgggaaagacagctggtctggtttttcctctcatactggacagcaataatcataatctacttctggataaaattatc
agccaacatggacccagccaagcttgtcagcagccaggggaataacatctgtgtggataaaaagccagcctag
>gnl|bcl2dbcds|F1MQX4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Bos taurus GN=MCL-1 (length=753 residues).
tgtcaacctcccccaccaactgaagagatggaatccctgatctccgatgccatcatgtcgcccgaagaggagccggacgg
gtgcaagccagaccctctcgggaagcggcctgccgtccggcctttacctttgttggtcagagaagccagtaacaacagtc
caggctcggacggctcgctgccctcgacgccgcccccagcagaggaggaggaggacaagttatattggcagtccctggag
attatctctcggtacctccgggagcaggcaaccggcgccaaggatgtgaagcccctgggcgggtctggggccaccagccg
gaaggcgttggagaccctgcaccgagtcggggatggggtgcagcacaaccacgagacggctttccaaggcgtgcttcaga
aactggacatcaaaaacgaagacgatgttaaatctttgtctcgagtgatggttcatgttttcagtgacagagtaacaaac
tggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacactttaagagtataaatcaagaaagctgcat
cgaaccactagcagaaagcatcacagatgttctcgtaaggtcaaaacgagactggatagtcaaagaaagaggctgggatg
ggtttgtggagttcttccatgtagaggacctagaaggcggcatcagaaatgtgctgctggcttttgcaggtgttgccgga
gtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|F1MV39_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos taurus GN=BCL2L10 (length=555 residues).
ggagccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctgcgcccgggagccggg
cactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaagcaaatcgaa
atgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcgacgaa
gaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagaggccgccgcagactac
ccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttctgcg
aaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccagtcattccagccatct
tgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctggataaaatta
>gnl|bcl2dbcds|F6R2C4_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos taurus GN=BCL-2 (length=690 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgcgccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgaggggacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggacgc
ctttgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataagtga
>gnl|bcl2dbcds|O02718_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Bos taurus GN=BCL-2 (length=687 residues).
atggcgcacgcggggggaacaggctacgataaccgagagatcgtgatgaagtacatccactataagctgtcgcagcgggg
ctacgagtgggatgccggagacgcgggcgccgcgccccccggggccgctcccgcgccgggcatcctgtcctcccagccgg
gccgcacacccgccccctccaggacctccccgccgccgcccccggccgccgccgccgggcctgcgcccagcccggtgccg
cctgtggtgcacctgaccctgcgccaggccggcgatgacttctctcggcgctaccgccgcgacttcgccgagatgtccag
tcagctgcacctgacgcccttcaccgcgagggaacgcttcgccacggtggtggaggagctcttcagggacggggtgaact
gggggcgcatcgtggccttctttgagttcggaggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtg
gacagcatcgccctgtggatgaccgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggacgc
ctttgtggagctgtatggccctagcatgcggcccctgtttgatttctcctggctgtctctgaaggcactgctcagtctgg
ccctggtgggcgcttgcatcaccctgggtgcctatctgggccataag
>gnl|bcl2dbcds|Q05KI8_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Bos taurus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggtcggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|Q05KJ0_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Bos taurus GN=BCL2L1 (length=702 residues).
atgtctcagagtaaccgggagctggtggttgactttctctcttacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacagaactgaggccccagaagggacagaatcagatatggaaacccccagtgccatcaatggca
acgcatcctggcacctggcggatagccctgctgtgaatggagccactggccacagcagaagctcggatgcccgggaagtg
atccccatggcagcggtgaagcaagccctgagggaggcaggcgatgagtttgaactgaggtaccgacgggcattcagcga
cctgacgtcccagctccacatcaccccagggacagcatatcagagctttgaacaggtagtgaatgaactcttccgggacg
gggtgaactggggtcgcattgtggcctttttctccttcggtggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcaacttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctacgggaacaatgcagcagccgagagccggaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggctggtgtggttctgctgggctcgctcttcagtcggaaatga
>gnl|bcl2dbcds|Q1RMX3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Bos taurus GN=BCL2L2 (length=582 residues).
atggcgaccccagcctcggccccagacacacgggctctagtggcagactttgtgggctataagctgaggcagaaggggta
tgtttgtggagctggccccggggagggcccagcagctgacccgctacaccaagccatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctccgatctggcagctcagctgcatgtgaccccgggctcggcccagcaacgcttcacc
caggtctctgatgaactcttccaagggggccccaactggggccgccttgtggccttctttgtctttggagccgcgttgtg
tgctgagagtgtcaacaaggagatggagccacttgtgggacaagtgcaggagtggatggtggcctacctggagacgaggc
tggctgactggatccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcgg
cgtctgcgggaggggaactgggcttcagtgaggacagtgctgacgggggctgtggcactgggggccctggtaactgtagg
ggccttttttgctagcaagtga
>gnl|bcl2dbcds|Q3C2I0_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Bos taurus GN=BCL2A1 (length=528 residues).
atgactgacactgagtttggctacgttcacgggctggctgaggactatctgaaatatgtgttgcagatacagcaacctgg
atccaagccaagcaaaacatccagggtgttacaagatgtggcttcctctgtccaggacgaagtggaaaggactctgaagc
agtgcttggataagtttgatgtggtgtccgtagacactgccagaacaatattcaaccaagtgatggaaaaggaatttgaa
gatggcattgttaactggggcaggattgtaaccatattcgcctttgaaggtattcttaccaagaaacttctgggcaagtg
tattgcctcagacatggacatgtgcaaggacatttctttctttgtggcggagttcatcaccgaaaatacaggagagtgga
taaagcaaaatggaggctgggaaaatgggtttgtaaagaagtttgaaaccaaatctggctggctgacttttctggaagtt
acaggaaagatctgtgaaacattatgtcgcctgaagcaatactattga
© 1998-2018