Dataset for CDS BCL2L10 of organism Bos taurus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|E1B9B3_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos taurus GN=BCL2L10 (length=633 residues).
ggagccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctgcgcccgggagccggg
cactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaagcaaatcgaa
acgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcgacgaa
gaccctggccccagctggggccgcgtggcctcactcgtaaccttcgcggggtcgctgctggagaggccaccgcagacgac
ccgacggcaggagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttct
gcgaaaggcaccgcgcctggctgatgactaacggcggctgggatggattttgtctcttcttcagccactcattccagcca
tcttgggaaagacagctggtctggtttttcctctcatactggacagcaataatcataatctacttctggataaaattatc
agccaacatggacccagccaagcttgtcagcagccaggggaataacatctgtgtggataaaaagccagcctag
>gnl|bcl2dbcds|F1MV39_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Bos taurus GN=BCL2L10 (length=555 residues).
ggagccatggtggacccgtttagggagcgcaccgcccggctgctgatggactacctggagttctgcgcccgggagccggg
cactccagctcctgcgccgtccacgcctgaggctgccgtgctgcgccacgtggccgcacgtatccaggaagcaaatcgaa
atgtcttgcccctataccgccgctgccgcaggcaccgcgtcgagctggtggccaggatggcgcagaggctactcgacgaa
gaccctggccccagctggggccgcgtggcctcactcgtgaccttcgcggggtcgctgctggagaggccgccgcagactac
ccgacggcagaagagagacgacgacggcgttagcagggactgtcggctcctggtggcccttctgtgtgctcagttctgcg
aaaggcaccgcgcctggctgatggctaacggcggctgggatggattttgtctctttttcagccagtcattccagccatct
tgggaaagacagctggtctggtttttcctcgcatactggacagcaataatcataatctacttctggataaaatta
© 1998-2018