Dataset for CDS Unclassified of organism Atta cephalotes

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A158N8X4_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Atta cephalotes (length=969 residues).
atgagatgtgagaacggcgcatcaccgaggaaacttgagaagacgttggaaaacggaagcgatctcgacggaggcgagga
atggcgcttagtgggtatggttccttgctccagtccggtacgcgagaagaggatggccggcgacgacgggacgacgacga
acaatgagatcctcggcgcggagggtggggaggaggagcagggtacgtcagcgcgaggggaactgcattccagagtgggc
ggcattctggaatgcgatccccccggtaacaggaattcgtcgaacgagcgacccgccgccaccgctgctgctaacaacga
ggacggtgtctgccgatatgcggtcggcgctgctaaccgcgctatgtctttcttcgagatgtgccagattcgactacaat
atttgttcccgcaactgagtccacctccacgttacaatatccacgatgattccatagaatcgactgcggaaatcttggcc
aatgatgtgatgcgatacttattaaaggaggacatctatcttatatcccaggatccagtctcccgcagtatgagacacaa
tgtatatcaaatgctcaacaaacacagcattctctttacgagtatggtaaatcgtttaaacgtcgtcccggataccgctt
atgaaacattcatgggggtcgccaacgagctgttcttacacggcgttatcacatgggccagaattgtctgtttatatgct
tttatgggcagattggctttatgggctagggacagaagaatgcacagtcttaaaaagaaattgcctttatacgtctctag
atatgttggtgaaaatataacacactttatcaaaggctatggtggatgggaacaattatgtgttgagtatcctgtagccg
aagaagttagtggagcagtttggcggagtctactaatgacaggagctactcttggtttgatcgccacgatcttgtcagtg
acttcctga
© 1998-2018