Dataset for CDS Unclassified of organism Astyanax mexicanus

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|A0A3B1J8Y8_uncMCL1-01 Putative Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astyanax mexicanus (length=624 residues).
aaagaggagaagctgccccggacggagcggccggaccgcggcctggagggactgcagtccgctaaaggagcctccatggg
cggcgggtctctgcccgactccccgcgggcggacgaagacttcatcccggactttagctgccgctgcccgggcttttacc
gcgggtacctgggccagaagccccgggagcagagcccggccctacggaccatgagccgggtggtggcgggggtcgtcttc
aaacacgggatcgcctacaacggtatggtccagaagctgaatttggaggagcaggacgacagtatggactttattagcag
cgtagctaagactctgtttagcgacggaaaccacgaactgcggatcttaagcctggtggcgtcggtgtgtgttgacatgc
tgaagaaggaagagtcgagatcactgcaccacttgtatcactttgcatcacttatatcacttatatttgtgtgtgtgtgt
gtgtataatgtgtgtgtttttgtgttgcaggagggatttgtggagttctctgaagtgaaaggtcagaatctgctggttaa
atctctgaaggctgtatcaagagttgcagggctggggttcagtatgttcctgctgcactggtaa
>gnl|bcl2dbcds|A0A3B1JPB0_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Astyanax mexicanus (length=657 residues).
atggccaatgaaagtccgtacgacagccgggacatcgtggagaaatatctctaccacaaacttctcaagcgcggctacgt
atgggagttccgcccggcctccgccgctgcctccgccaccgccgccgccgccaactccacctccgcagcctcagcggacg
acgacaacgacgacgaggccgagcctgagcgcgccgggcccgcgaggctgcaccggctcctgcgcgaggcaggcgacgag
ctcgagcgcgtctaccagcgggacttcgccgccatgtgggaccagctgcgcgtgggacccagcgcgcagctccagcgcag
ctttgtggccgtggcggaggagctgttcggggacggggtgaactggggccgcgtcgtggccttcttcgagttcggcggca
cgctgtgcgtggagagcgtgaaccgcgagatggcgtcgcaggtggagcacatcgcgcggtggatgaccgactacctgaac
gggccgctgctgcagagctggatccaggacaacgggggctgggatggctttgtggaaatctacagtcagcagagaaggtc
cattttccatccctggccctatctaaagacagtgtttggtctggcagctctgggggcggcaggagtaaccatcggagctc
tcttcactcagaagtga
>gnl|bcl2dbcds|W5K2Q2_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Astyanax mexicanus (length=606 residues).
atggccagcaaaaacgacatggtggtgtacgacagccgcggcatagtggagaactatctgcaccacaagctggccaagag
cggtcacgcaagaggagaagaagaagaggaggatgaagaagaagaggggaaaagggtgcatccagctccaccggccgtgc
acggagctctgcgcgaggctggagacgagctggagcggctgtaccgctcggatctgaccgacatgaccgggcggctcgag
ctggagcccgcgggcgcgcgccggagcttcgcggcggtggcggacgagctgttccgggacggggtgaactgggggcggat
cgtggcgttcctggagttcggcgcggccgtgtgcgtggagcggaagcggaccgccgccgagggcatcaccgcggacgtgg
ctcgctggatgaccgagtacctgaacggaccggtgctgagggggtggatacgggagaacggaggatgggatgccttcgtg
gatctgtacggccggcagaaggactcagtattcggcagctcttggccgtctatagtgacggtgttcagcctggcggcact
gggggccgtgggcttcactataggagcgtacctcgctcagaaatga
© 1998-2019