Dataset for CDS Unclassified of organism Astyanax mexicanus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W5K2Q2_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Astyanax mexicanus (length=606 residues).
atggccagcaaaaacgacatggtggtgtacgacagccgcggcatagtggagaactatctgcaccacaagctggccaagag
cggtcacgcaagaggagaagaagaagaggaggatgaagaagaagaggggaaaagggtgcatccagctccaccggccgtgc
acggagctctgcgcgaggctggagacgagctggagcggctgtaccgctcggatctgaccgacatgaccgggcggctcgag
ctggagcccgcgggcgcgcgccggagcttcgcggcggtggcggacgagctgttccgggacggggtgaactgggggcggat
cgtggcgttcctggagttcggcgcggccgtgtgcgtggagcggaagcggaccgccgccgagggcatcaccgcggacgtgg
ctcgctggatgaccgagtacctgaacggaccggtgctgagggggtggatacgggagaacggaggatgggatgccttcgtg
gatctgtacggccggcagaaggactcagtattcggcagctcttggccgtctatagtgacggtgttcagcctggcggcact
gggggccgtgggcttcactataggagcgtacctcgctcagaaatga
© 1998-2018