Dataset for CDS BCL-2-like of organism Astyanax mexicanus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|W5LC19_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Astyanax mexicanus GN=BCL2L1 (length=717 residues).
atgtcgtactataaccgagaattagtggtgtactttattaagtacaaactctcacagaggaactatcctactaatcacat
cggactcgtggaagaaacaaatcgaactgaagggggccaggaagcggaggggaacgcagaggcggccgcggtgactccca
ccgcagtcgttaacgggtccgtaaatgggacgagtcacggtgcggcagggtcgcccacctcgtccccccagagaagggcc
aacggggctcgggggctggatgcagtgaaagaggcactgcgggactcagccaacgagtttgagctgcgatactctcgcgc
cttcagcgacctgtcctcccagctgcacatcacgcctgctactgcgtaccagagctttgagagcgtgatggacgaggtgt
ttcgcgatggcgtcaactggggccgcgtcgtaggtttgttcgctttcggcggggctctgtgtgtggagtgcgtggagaag
gagatgagccccctggtgggacgcatcgcagagtggatgaccgtctacttggacaaccacatccagccctggatccagga
gcaaggaggatgggaacgctttgcagagatctttgggaacgacacagcagcagagagcagaaggatgcaggaacgctata
agatgtggctgctggtggggatgaccctgttcacaggaattgtggtgggctctctcatcgctcagaagcgtctgtaa
>gnl|bcl2dbcds|W5LHQ4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astyanax mexicanus GN=MCL-1 (length=594 residues).
gacgacggctcagtgcccagctcccccttgtcggactgcggggagatggccgttgggaactgcaagcagtacgaaacgct
ggacggagacacgcgagagattatcagtgactttctgaggaacttttgcggactctctcggtcctgtggaggacacggtg
cggttgtacagacaatgaagcgggtggtggacgatctggtggtcaaacatgggattgcgtacaaaggtatgttgaacaaa
ctgggtatggaagacagaggagatgacatgtatgtaattagggcagtagctaaggagctattcagtgatggcatcaccaa
ctggggcagggtcgccagcctggtggcctttggagcagtggtgtccaagcatcagcatgacatgggccgaggccactgtg
tgagtctagtgggtgaagaactatcctcatatcttctgtcagacgaaagggactggctcctaaaaaacaaagcatgggat
ggctttgtggagttttttcgtgttcctgatcctgagtcaacgatgagaaatgcattaatggcctttgttactgtggcagg
tcttggagcctcaatagcatttttggcaagataa
© 1998-2018