Dataset for CDS Unclassified of organism Astatotilapia calliptera

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3P8Q7X1_uncBCL2-01 Putative B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Astatotilapia calliptera (length=597 residues).
atggccgccgcctacagcagccgggacctggtggaggacttcctgcgctacaagctgctcggcaggggcgtggcttggcc
tcagcgccgggccaatgacgagagagccccgcgtccagaccctcctgtggccccaccctgcctgcagaccgtgctgcgga
gcgccggcgatgagttggagcgactttacggcaacgagctgtctgcgcaggtgacggtgctgcaactgcgtgggaacggc
ggtggcgctgcacgccggcgccacctgacggctatcagagaggagctgttcagggatggcgtgaactggggacgcatcgt
cgccatgatggagctgggcggagctctgagcgccgcggccgccaagtcgggcgacgaaggtcagatggacgatatcgcca
gctggatggaggagagtctggactcgccgtcgctccggagatggatccatgacaacggaggatgggatgcttttgtggag
ctgtatgagtccagacccactgacagcttctggtccctgaggacagtgtgtggactggtcgtactgggagcagttggggt
catactgggatttctattcagccagaaacaaaactga
© 1998-2019