Dataset for CDS MCL-1 of organism Astatotilapia calliptera

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|A0A3P8NP63_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astatotilapia calliptera GN=MCL-1 (length=834 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagatcttctacaatcttttga
>gnl|bcl2dbcds|A0A3P8NP63_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astatotilapia calliptera GN=MCL-1 (length=837 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagttgctgggatgcattattgtga
>gnl|bcl2dbcds|A0A3P8NP63_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Astatotilapia calliptera GN=MCL-1 (length=825 residues).
atggccaactatatgatgttgaaaaggaaccagtgcaccttaatggaatatcttattcctcaaaatggagtcttggaggg
accaatgcactacggatcgggaaattcctctccgcagaacgccacaggctcctctaaagactctagcaatgggattgtgt
ccaatggtacccccaaacggccggacaacctcgaggtaacctcaacaaacgggtataaaacaaaagctatccgggaccgg
gaggaagacggttcgttgccgagcaccccggagtttcattcggacagtgaatccgacgagcagctggagagagaaacgaa
actccttattcacagttttttgggtgactttattggactttctcagcctcaacgaaaagaaaccaaagcactaaagacga
tgaaaagagttgttgcggacgtattagaaaagcacagatacgcttacaacggaatgattaataaattgtcattggatgaa
agagacgaggatatgtcatttgtcggtgctgtagcgaagagcctctttggagaccacacgaccaactggggtcgtattgt
cagctttatggccttcggggcagtggtctctcagcacctgaaggaaaagggcagggacaactacgtggcgctagtgagcc
aagagatttctgcatacctgctgtctgaacagcgagactggattgtaaaaaacaatgcatgggatggctttgtggagttc
tttcgagtagcagaccctgagtcgatagtcaggcacacactcatggcctttgctggatttgctggtattggggcaacact
ggccctgttgatcagtggtttgtaa
© 1998-2019