Dataset for CDS Unclassified of organism Armadillidium vulgare iridescent virus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A068QLP8_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Viruses] Armadillidium vulgare iridescent virus (length=462 residues).
atggacgaaataccaaagataaccaaatgtgttgtaaacccttctttaattaccgacaaagaagggttaagaaaggatct
cgctgttgcagttttatatcttatcaaagaagtgttgaaattttcaaacaagaaagatgtaaatggagcagacaaattat
gccaagatcttttagcccaaaccccaaatgttaattttgaaacctctgtttaccaggtatttgaggaactgttcgcggaa
gggatttcgtggtataagattgcaactctctttgccttctgtcacattcttgccaccaaaaccacagtttcgttagttga
aagttcattacgaagctatatttctgattacctttttaaatgggtaagtgaaaacggtggatggaacggcttaatcattc
tagcaaataaatgcagcaataattattgcattgcgccggaccaaaataatgagggcaattag
© 1998-2018