Dataset for CDS MCL-1 of organism Aotus nancymaae

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A2K5C7L5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=717 residues).
atgtttggcctccaaagaaacgcgctaatcggactcaacctctactgtgagtgggccggcttggggactggcagtggcgg
caccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgtggtgattggcggaagcgccggcgctagcccctcggccgccctcacgcctgacgcccgggggtcgtgcggccgctgc
tggttcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccgacgccatcatgtcgcccga
agaagagctggacaggtacgagccggagcctctcgggaagcggccggctgtcctgcccctgctggagttggtggaggagc
ctggtaatgactccagtacggatgggtcactaccctcgacgccgccgacatcactggagattatctctcggtaccttcgg
gaacaggcgactggcgccaaggacacaaagccaatggacaggtccggggccgccagcaggaaggctctggagaccttacg
acgggttggggacggcgtgcagcgcaaccacgagacggccttccaagttcttccatgtagaagacctagaaggtggcatc
agaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatagccttgtaa
>gnl|bcl2dbcds|A0A2K5CFH3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=1059 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcctggtaatggctccagtacggacgggtcacta
ccctcgacgccgcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcact
gtctcttatacacatctag
>gnl|bcl2dbcds|A0A2K5CFH3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=600 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggcgctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcactgtctcttatacacatctag
>gnl|bcl2dbcds|A0A2K5CFH3_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=789 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcctggtaatggctccagtacggacgggtcacta
ccctcgacgccgcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
>gnl|bcl2dbcds|A0A2K5DMS4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=492 residues).
atgtttggcttccaagtggtaatcagactcaacctctactgcggtgccatccctccaggaccgcggcttttggcgactgg
cgccaaggacacaaagccaatgggcaggtctgaggccgccaacagtaaggcgctggagaccttacgaggggttggggaag
gcgtgccccgcaaccacgagatggccttacaaggcatgcttcggaatctggacaacaaaaacgaagacaatgtcaaatct
ttctacggcgtaacaaactggggtaggattgtgactctcagttcttttggtgcctttgtggccaaacacttgaagaccat
aaaccaagaaagttgcatcgaaccattagcagaaagtatcagatattctcgctgggatgggtttgtggagttcttccgtg
tagaggacttagaaggtggcatcagaaatgggctgctggctttcgcaggtgttgctggagtaggaactgatttggcatat
ctaataagatag
>gnl|bcl2dbcds|A0A2K5EPY9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=399 residues).
agccagagttataataacttaaagataaccacatgcatgcttcgaaaactggacatcaaaaacaaagacgatgtcaaatc
tttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggatcgtgactctcatttcttttggtg
cctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagtattacagacgttctc
gtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctaga
aggtggcatcagaaatgtgctgctggcttttgcatgtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5EPY9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=405 residues).
aatgcctcatgttccagacctgcatgcttttcttccccaggcatgcttcgaaaactggacatcaaaaacaaagacgatgt
caaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggatcgtgactctcatttctt
ttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagtattacagac
gttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcatgtgttgctggagtaggagctggtttggcatatctaataa
gatag
© 1998-2018