Dataset for CDS BCL-2-like of organism Aotus nancymaae

[Download (right click)] [Alignment] [Repertoires]

16 sequence(s)

>gnl|bcl2dbcds|A0A2K5C7L5_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=717 residues).
atgtttggcctccaaagaaacgcgctaatcggactcaacctctactgtgagtgggccggcttggggactggcagtggcgg
caccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgtggtgattggcggaagcgccggcgctagcccctcggccgccctcacgcctgacgcccgggggtcgtgcggccgctgc
tggttcttcgcgcccacccgccgcgcggcgccgcttgaggagatggaagccccggccgccgacgccatcatgtcgcccga
agaagagctggacaggtacgagccggagcctctcgggaagcggccggctgtcctgcccctgctggagttggtggaggagc
ctggtaatgactccagtacggatgggtcactaccctcgacgccgccgacatcactggagattatctctcggtaccttcgg
gaacaggcgactggcgccaaggacacaaagccaatggacaggtccggggccgccagcaggaaggctctggagaccttacg
acgggttggggacggcgtgcagcgcaaccacgagacggccttccaagttcttccatgtagaagacctagaaggtggcatc
agaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataagatagccttgtaa
>gnl|bcl2dbcds|A0A2K5CFH3_MCL1-03 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=789 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcctggtaatggctccagtacggacgggtcacta
ccctcgacgccgcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggc
>gnl|bcl2dbcds|A0A2K5CFH3_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=600 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagca
ggaaggcgctggagaccttacgacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcgg
aaactggacatcaaaaacgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaa
ctggggtaggattgtgactctcatttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgca
ttgaaccattagcagaaagtatcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggat
gggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctgg
agtaggagctggtttggcactgtctcttatacacatctag
>gnl|bcl2dbcds|A0A2K5CFH3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=1059 residues).
atgtttggcctccaaagaaacgcggtaatcggactcaacctctactgtgggggggccggcttgggggccggcagcggcgg
cgccacccctccgggagggcggcttttggccacggagaaggaggcctcggcccagcgagaggtagggggaggggaggccg
gcgcggtgattggcggaagcgccggcgctagccccccggccgccctcgtgcctgacgcccggagggtcgtgcggccgccg
cccattggcgccgaggtccccgacgtcaccgcgaccccctcgaggctgctgttcttcgcgcccacccgccgcgcggcgcc
gcttgaggagatggaagccccggccgccgacgccatcatgtcgcctgaagaagagctggacgggtacgagccggagcctc
tcgggaagcggccggctgtcctgcccctgctggagttggtcggggagcctggtaatggctccagtacggacgggtcacta
ccctcgacgccgcctccagcggaggaggaggaggacgagttgtaccggcagtcgctggagattatctctcggtaccttcg
ggagcaggcgaccggcgccaaggacacaaagccaatgggcaggtccggggccgccagcaggaaggcgctggagaccttac
gacgggttggggacggcgtgcagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaacgaa
gacgatgtcaaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggattgtgactct
catttcttttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagta
tcacagacgttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccat
gtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcact
gtctcttatacacatctag
>gnl|bcl2dbcds|A0A2K5CWZ4_BCL2L2-02 BCL2-like 2 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L2 (length=651 residues).
atgccccttctggttctctgtccatatattcatgccagtctttcatccttgcctcttatagccgcccggatggcgacccc
agcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggttatgtctgtggag
ctggccccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgagttcgagacccgcttc
cggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacccaggtctccga
tgaacttttccaagggggccctaactggggccgccttgtagccttctttgtctttggggctgcactgtgtgctgagagtg
tcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggctggccgactgg
atccacagcagtgggggctgggcggagttcacagctctatacggggacggggccctggaggaggcgcggcgtctgcggga
ggggaactgggcatcagtgaggacagtgctgacaggggccgtggcactgggggccctggtaactgtaggggccttttttg
ctagcaagtga
>gnl|bcl2dbcds|A0A2K5CWZ4_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L2 (length=615 residues).
catctttcatccttgcctcttatagccgcccggatggcgaccccagcctcggccccagacacacgggctctggtggcaga
ctttgtaggttataagctgaggcagaagggttatgtctgtggagctggccccggggagggcccagcagctgacccgctgc
accaagcaatgcgggcagctggagatgagttcgagacccgcttccggcgcaccttctctgatctggcggctcagctgcat
gtgaccccaggctcagcccaacaacgcttcacccaggtctccgatgaacttttccaagggggccctaactggggccgcct
tgtagccttctttgtctttggggctgcactgtgtgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgc
aggagtggatggtggcctacctggagacgcggctggccgactggatccacagcagtgggggctgggcggagttcacagct
ctatacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactgggcatcagtgaggacagtgctgacagg
ggccgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
>gnl|bcl2dbcds|A0A2K5CWZ4_BCL2L2-03 BCL2-like 2 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L2 (length=1041 residues).
atggcgaccccagcctcggccccagacacacgggctctggtggcagactttgtaggttataagctgaggcagaagggtta
tgtctgtggagctggccccggggagggcccagcagctgacccgctgcaccaagcaatgcgggcagctggagatgagttcg
agacccgcttccggcgcaccttctctgatctggcggctcagctgcatgtgaccccaggctcagcccaacaacgcttcacc
caggtctccgatgaacttttccaagggggccctaactggggccgccttgtagccttctttgtctttggggctgcactgtg
tgctgagagtgtcaacaaggagatggaaccactggtgggacaagtgcaggagtggatggtggcctacctggagacgcggc
tggccgactggatccacagcagtgggggctgggagctggaagctatcaaagctcgagtcagggagatggaggaagaagct
gagaagctaaaagaactacagaacgaggtagagaagcagatgaatatgagtccacctccaggcaatgctggcccagtgat
catgtccattgaggagaagatggaggctgatgcccgttccatctatgttggcaatgtggactatggtgcaacagcagaag
agctggaagctcactttcatggctgtggttcagtcaaccgtgttaccatactctgtgacaaatttagtggccatcccaaa
gggtttgcatatatagagttctcagacaaagagtcagtgaggacttccttggccttagatgagtccctatttagaggaag
gcaaatcaaggttgactttaaggctttcatttattcatctctgactcaggtgatcccgaaacgaaccaacagaccaggca
tcagcacaacagaccggggttttccacgagcccgctaccgcgcacggaccaccaactacaacagttcccgctctcgattc
tacagtggttttaacagcaggccccggggtcgcgtctacaggggccgggctagagcgacatcatggtattccccttacta
a
>gnl|bcl2dbcds|A0A2K5D2I1_BCL2A1-02 BCL2-related protein A1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2A1 (length=492 residues).
atgacagactgtgaatttggatatattcacaatctaactcaggactatctgcggtacgtcctgcagataccacaatctgg
aacgggtccaagcaaaacgtccagggtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagagtctgaagc
catgcttggacaatgttaatattgtgtccatagataatgccagaatgatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taagtcaaaacggaggctgggcgaaatggcacagtctcctgcttgtgctggtggagtcagtggcccagaaggagaggaaa
atggctttgtaa
>gnl|bcl2dbcds|A0A2K5D2I1_BCL2A1-01 BCL2-related protein A1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2A1 (length=528 residues).
atgacagactgtgaatttggatatattcacaatctaactcaggactatctgcggtacgtcctgcagataccacaatctgg
aacgggtccaagcaaaacgtccagggtgctacaaaaggttgcattctcagtccaaaaagaagtggaaaagagtctgaagc
catgcttggacaatgttaatattgtgtccatagataatgccagaatgatattcagtcaagtgatggaaaaggaatttgaa
gatggcattattaactggggaagaattgtaaccatatttgcatttgaaggtattctcatcaagaaacttctacgagagcg
aattgccccggatgtggatacttacaaggagatttcgtattttgttgctgagttcataatgaataacacaggagaatgga
taagtcaaaacggaggctgggaaaatggctttgtaaagaagtttgaacctaaatctggctggatgacttttctagaagtt
acaggaaagatctgcgaaatgctatctctcttgaagcaatactattga
>gnl|bcl2dbcds|A0A2K5DMS4_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=492 residues).
atgtttggcttccaagtggtaatcagactcaacctctactgcggtgccatccctccaggaccgcggcttttggcgactgg
cgccaaggacacaaagccaatgggcaggtctgaggccgccaacagtaaggcgctggagaccttacgaggggttggggaag
gcgtgccccgcaaccacgagatggccttacaaggcatgcttcggaatctggacaacaaaaacgaagacaatgtcaaatct
ttctacggcgtaacaaactggggtaggattgtgactctcagttcttttggtgcctttgtggccaaacacttgaagaccat
aaaccaagaaagttgcatcgaaccattagcagaaagtatcagatattctcgctgggatgggtttgtggagttcttccgtg
tagaggacttagaaggtggcatcagaaatgggctgctggctttcgcaggtgttgctggagtaggaactgatttggcatat
ctaataagatag
>gnl|bcl2dbcds|A0A2K5EB04_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Aotus nancymaae GN=BCL-2 (length=723 residues).
atggcgcacgctgggagaacagggtacgataaccgagagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagatgtgggcgccgcacccccaggggccgcccccgcgccgggcatcttctcctcccagcctg
gacacacgcccggtcccgccgcgccccgggacccggtctccaggacctcgccgccgccgcccccggccgcccccgccgcc
gccgccacggggcctgcgctcagcccggtgccacctgtggtccacctgaccctccgccaggccggggacgacttctcccg
ccgctaccgccgcgacttcgccgagatgtccagccagctgcacctgacgcccttcaccgcgcggggacgctttgccacgg
tggtggaggagctcttcagggacggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtg
gagagcgtcaaccgggagatgtcgcccctggtggacaacatcgcgctgtggatgaccgagtacctgaaccggcacctgca
cacctggatccaggataacggaggctgggatgcctttgtggaactgtatggccccagcatgcggcctctgtttgatttct
cctggctgtctctgaagactctgctcagcttggccctggtgggagcttgcatcaccctgggtgcctatctgggccacaag
tga
>gnl|bcl2dbcds|A0A2K5EBP4_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L1 (length=702 residues).
atgtctcagagcaaccgggagctggtggttgactttctctcctacaagctttcccagaaaggatacagctggagtcagtt
tagtgatgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatggca
acccatcctggcacctggcggacagccccgcggtgaatggagccacgggccacagcagcagtttggatgcccgggaggtg
atccccatggcagcagtaaagcaagcactgagggaggcgggcgacgaatttgaactgcggtaccggcgggcatttagtga
cctgacatcccagctccacatcacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatg
gggtaaactggggtcgcattgtggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcag
gtattggtgagtcggatcgcagcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcgg
ctgggacacttttgtggaactctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggt
tcctgacgggcatgactgtggccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K5EBP4_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L1 (length=441 residues).
atgtggaagagaacaggactgaggccccagaagggactgattcggagatggagacccccagtgccatcaatgctccacat
cacccccgggacagcgtatcagagctttgaacaggtagtgaacgaactcttccgggatggggtaaactggggtcgcattg
tggcctttttctccttcggcggggcactgtgcgtggaaagcgtagacaaggagatgcaggtattggtgagtcggatcgca
gcttggatggccacttacctgaatgaccacctagagccttggatccaggagaacggcggctgggacacttttgtggaact
ctatggaaacaatgcggcagccgagagccgaaagggccaggagcgcttcaaccgctggttcctgacgggcatgactgtgg
ccggcgtggttctgctgggctcactctttagtcggaaatga
>gnl|bcl2dbcds|A0A2K5EPY9_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=405 residues).
aatgcctcatgttccagacctgcatgcttttcttccccaggcatgcttcgaaaactggacatcaaaaacaaagacgatgt
caaatctttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggatcgtgactctcatttctt
ttggtgcctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagtattacagac
gttctcgtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagagga
cctagaaggtggcatcagaaatgtgctgctggcttttgcatgtgttgctggagtaggagctggtttggcatatctaataa
gatag
>gnl|bcl2dbcds|A0A2K5EPY9_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Aotus nancymaae GN=MCL-1 (length=399 residues).
agccagagttataataacttaaagataaccacatgcatgcttcgaaaactggacatcaaaaacaaagacgatgtcaaatc
tttgtctcgagtgatggtccatgttttcagcgacggcgtaacaaactggggtaggatcgtgactctcatttcttttggtg
cctttgtggccaaacacttgaagaccataaaccaagaaagctgcattgaaccattagcagaaagtattacagacgttctc
gtaaggacaaaacgggactggctagttaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggacctaga
aggtggcatcagaaatgtgctgctggcttttgcatgtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|A0A2K5F974_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L10 (length=642 residues).
atggctgacccgctgcggcagcgcaccgagcggctggtggcggactacctggagtactgctcccaggagcctggcacccc
cgagtcgccgccgtccacggccgaggccgctgtgctgcgcgccatggccgccggtgtacggaaactctaccggtccttct
tctccgcctacctcggctacccggggaaccgcgtcgagctggtggcgaggatggcggaggccctgctctccgacagtccc
ggccccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggggccgctggtgaccgcccg
gtggaagaagtggggcttccagtcgcggctgaaggagccggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgtggggcagcaccgtgcctggctggaggctcagggcggctgggtgagcatgcggagggggaca
cgggcctcccgagtagctgggaatataggatggcttttgttacttcttcaggacctcctcctcgctggcattatggagaa
aactgctggtccaggttttcctgtcatggttgttaacagcagcattcatctacttctggacacgataattaggagttttt
aa
© 1998-2018