Dataset for CDS BCL2L10 of organism Aotus nancymaae

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A2K5F974_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Aotus nancymaae GN=BCL2L10 (length=642 residues).
atggctgacccgctgcggcagcgcaccgagcggctggtggcggactacctggagtactgctcccaggagcctggcacccc
cgagtcgccgccgtccacggccgaggccgctgtgctgcgcgccatggccgccggtgtacggaaactctaccggtccttct
tctccgcctacctcggctacccggggaaccgcgtcgagctggtggcgaggatggcggaggccctgctctccgacagtccc
ggccccacctggggcaacgtggtgatgctcctggccttcgcggggacgctgctagagagggggccgctggtgaccgcccg
gtggaagaagtggggcttccagtcgcggctgaaggagccggagggcgacgtcgcccgggactgccagcgcctggtggcct
tgctgagctcgcggctcgtggggcagcaccgtgcctggctggaggctcagggcggctgggtgagcatgcggagggggaca
cgggcctcccgagtagctgggaatataggatggcttttgttacttcttcaggacctcctcctcgctggcattatggagaa
aactgctggtccaggttttcctgtcatggttgttaacagcagcattcatctacttctggacacgataattaggagttttt
aa
© 1998-2018