Dataset for CDS MCL-1 of organism Anas platyrhynchos

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|U3IRH3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anas platyrhynchos GN=MCL-1 (length=465 residues).
cattttgggctggtttcacccaactcagaagcgagctcccgagccagctgcggggggggagcaggggggggtcaccgagt
ctctgagccaacctctcttgcaggaatgcttcggaagctggaaatcaagaaggaggaggacctgcaggccgtgggtgagg
tggcggcccacctcttcagcgacggggtgaccaactgggggcgcgtcgtcaccctcatctccttcggcgccttcgtcgcc
cggcacctgaaaagcgtaaagcaggagaaaagcatcggctccctggccaggatcatcaccgacctcgtctcgtccaaacg
cgagtggctcgtgagccagggaggctgggagggtttcgtcgactttttccgagtggaagacctggaaggcagcatcagga
acgtgctgatggcgttcgcaggagtggctggactgggagcgagcttggcctacatgatccggtga
© 1998-2018