Dataset for CDS BCL-2-like of organism Anas platyrhynchos

[Download (right click)] [Alignment] [Repertoires]

3 sequence(s)

>gnl|bcl2dbcds|U3II49_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anas platyrhynchos GN=BCL-2 (length=312 residues).
ggactccacctcgccctgcgccaggccggggacgagttctcccgtcgctaccagcgggacttcgcccagatgtccggcca
gctgcacctgacaccnnnnacggccagaggccgcttcgtggccgtggtggaggagctcttccgagacggggtgaactggg
gccggatcgtggccttcttcgagttcggcggcgtcatgtgcgtggagagcgtcaaccgggagatgtctcccctggtggac
agcatcgccgcctggatgaccgagtacctgaaccggcacctgcacaactggatccaggacaacggaggctgg
>gnl|bcl2dbcds|U3IRH3_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anas platyrhynchos GN=MCL-1 (length=465 residues).
cattttgggctggtttcacccaactcagaagcgagctcccgagccagctgcggggggggagcaggggggggtcaccgagt
ctctgagccaacctctcttgcaggaatgcttcggaagctggaaatcaagaaggaggaggacctgcaggccgtgggtgagg
tggcggcccacctcttcagcgacggggtgaccaactgggggcgcgtcgtcaccctcatctccttcggcgccttcgtcgcc
cggcacctgaaaagcgtaaagcaggagaaaagcatcggctccctggccaggatcatcaccgacctcgtctcgtccaaacg
cgagtggctcgtgagccagggaggctgggagggtttcgtcgactttttccgagtggaagacctggaaggcagcatcagga
acgtgctgatggcgttcgcaggagtggctggactgggagcgagcttggcctacatgatccggtga
>gnl|bcl2dbcds|U3IS71_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anas platyrhynchos GN=BCL2L1 (length=681 residues).
atgtccagcggcaaccgggagctggtgatcgactttgtctcctacaagctgtcgcagaaaggctacagctggagccagct
ggaggaagaggatgagaacaggactgagttggcttccgaggccgccgcggtgctcaacgggagcccctcctggcaccccc
cagctggccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgagcttgttcaatcggccgccgtc
cggcaggctctgcgcgaagccggggatgaattcgagctgaggtaccgccgggctttcagcgacctcacctcccagctcca
catcacccccggcacggcttaccagagcttcgagcaggtggtgaacgaacttttccgcgatggggtgaactgggggcgca
tcgtggccttcttctccttcggaggggcgctgtgcgtggagagcgtggacaaggagatgagggtcctggtggggcgcatc
gtggcctggatgaccacctaccggagggcagagctggagaaagcattttctgagggaggagggatggagcggtttgtgga
cctctacgggaacgatgctgctgcggagatgaggaagggccaggaaaccttcaacaaatggctcctgaccggggccacgg
tggccggagtgctcctgctgggatccctgctgagcccaagt
© 1998-2018