Dataset for CDS BCL2L1 of organism Anas platyrhynchos

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|U3IS71_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anas platyrhynchos GN=BCL2L1 (length=681 residues).
atgtccagcggcaaccgggagctggtgatcgactttgtctcctacaagctgtcgcagaaaggctacagctggagccagct
ggaggaagaggatgagaacaggactgagttggcttccgaggccgccgcggtgctcaacgggagcccctcctggcaccccc
cagctggccaggtagtgaacggcgccgccgtgcaccggagcagcctggaggtccacgagcttgttcaatcggccgccgtc
cggcaggctctgcgcgaagccggggatgaattcgagctgaggtaccgccgggctttcagcgacctcacctcccagctcca
catcacccccggcacggcttaccagagcttcgagcaggtggtgaacgaacttttccgcgatggggtgaactgggggcgca
tcgtggccttcttctccttcggaggggcgctgtgcgtggagagcgtggacaaggagatgagggtcctggtggggcgcatc
gtggcctggatgaccacctaccggagggcagagctggagaaagcattttctgagggaggagggatggagcggtttgtgga
cctctacgggaacgatgctgctgcggagatgaggaagggccaggaaaccttcaacaaatggctcctgaccggggccacgg
tggccggagtgctcctgctgggatccctgctgagcccaagt
© 1998-2018