Dataset for CDS MCL-1 of organism Anas platyrhynchos platyrhynchos

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A493U0E8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anas platyrhynchos platyrhynchos GN=MCL-1 (length=978 residues).
ggagggtgggggacggagtcctggagaaacacgagctggccttccaagggaccggcgagatctgaccatttggggtcagt
tttgtggaaatcggaggcgagctctcagggaccagcaagaattgaccattttgggtcagttccatggaattcagaggcga
gtccccggggagtggtgggaactgcccattttgggtcagttttgtggaactcggaagcgagcccctggggatggggcgga
accgaccattttggggctgttttcccagaacccagcagcgggattttttccagaccagcacgtaccaaccctttgggatc
agctccacggggacgggggggagatttgaccattttgggctggtttcacccaactcagaagcgagctcccgagccagctg
ggcggcgagacgccgcccctcccgcagcaggatgttgcacttttaaaaaatgcaaaaggtttcgagccggcccccacccc
ttccctcatcaccctgctgggcgagatttttggggtttcaccacccccggccaaatttttggggtgctggcaaggaaacc
acactcgggggagcaggggggggtcaccgttgaggatttgggacgttcccttggaatgcttcggaagctggaaatcaaga
aggaggaggacctgcaggccgtgggtgaggtggcggcccacctcttcagcgacggggtgaccaactgggggcgcgtcgtc
accctcatctccttcggcgccttcgtcgcccggcacctgaaaagcgtaaagcaggagaaaagcatcggctccctggccag
gatcatcaccgacgccctcgtctcgtccaaacgcgagtggctcgtgagccagggaggctgggagggtttcgtcgactttt
tccgagtggaagacctggaaggcagcatcaggaacgtgctgatggcgttcgcaggagtggctggactgggagcgagcttg
gcctacatgatccggtga
© 1998-2019