Dataset for CDS BCL-2-like of organism Anabas testudineus

[Download (right click)] [Alignment] [Repertoires]

9 sequence(s)

>gnl|bcl2dbcds|A0A3Q1GX28_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anabas testudineus GN=MCL-1 (length=867 residues).
atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgagctgcttgatgcttcctcaaaatggagtcgt
agagtacagctcgggagtcaactcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaatgctgctctga
aacgacccaagaacctggacgtgagctcatcgaatggctatgcaacaaaaaacattggggctaacagcgacgacatcgaa
gacggatctttgccgtgcaccccggagctgatgtcggacagcgaggtcgatgtctccagttgtccagcaggggacgaggt
gctggagaacgacacgaggcagctcctaagccagtttctccaagacttttctggacttactaagcctcgttggtgtgaaa
ccaaagaactatcaacaatgaaaagggttgtgaatgacgttctggaaaaacacagatacgcgtacaatggtatgatcaac
aaactctcactggatgacaaagtggacgatgtgagttttatcacggcagtagcccagagccttttctcagatggaaccac
aaactggggtcgtatcgccagcctggtggcctttggggcagcagtgtgtcagcacctgaaggaaaaacacagggagaact
gtgtggatctggtggcacaggagatctcctcatacctgctgtcagcccagcgagactggctggtcaggaacaactcatgg
gatggttttgttgaattctttcgagtggcagaccctgaatccacagtgaggaaatcactcatggcctttgcaggattggc
tggtattggggcatcactggccctgttgatcagtgctgtccgacttcagcctcttcacctgcattaa
>gnl|bcl2dbcds|A0A3Q1GX28_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Anabas testudineus GN=MCL-1 (length=852 residues).
atgttaccgtcgggcagaacagctatgaaactagccacgggaggaatgagctgcttgatgcttcctcaaaatggagtcgt
agagtacagctcgggagtcaactcgccacagatcaccatgagctcctcgatagacgcttgcaacgggaatgctgctctga
aacgacccaagaacctggacgtgagctcatcgaatggctatgcaacaaaaaacattggggctaacagcgacgacatcgaa
gacggatctttgccgtgcaccccggagctgatgtcggacagcgaggtcgatgtctccagttgtccagcaggggacgaggt
gctggagaacgacacgaggcagctcctaagccagtttctccaagacttttctggacttactaagcctcgttggtgtgaaa
ccaaagaactatcaacaatgaaaagggttgtgaatgacgttctggaaaaacacagatacgcgtacaatggtatgatcaac
aaactctcactggatgacaaagtggacgatgtgagttttatcacggcagtagcccagagccttttctcagatggaaccac
aaactggggtcgtatcgccagcctggtggcctttggggcagcagtgtgtcagcacctgaaggaaaaacacagggagaact
gtgtggatctggtggcacaggagatctcctcatacctgctgtcagcccagcgagactggctggtcaggaacaactcatgg
gatggttttgttgaattctttcgagtggcagaccctgaatccacagtgaggaaatcactcatggcctttgcaggattggc
tggtattggggcatcactggccctgttgatcagctcctgtagtgtgatgtga
>gnl|bcl2dbcds|A0A3Q1GZ93_BCL2L1-03 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggttttctacataacatataaactatcccagagaaactatcctctcaaccacttggg
actcaatgagactcccaacaggactgatgggggggaagatgggttgagtgaggaacagcggatagcaacgcacgccaacg
ggacttttaatggtagaagtcccgggacccccccagcgtccccgctgcggcaacaacggttgccatcaacgacgagcctg
gatgcggtgaaagaggccctccgggactcggccaacgagtttgagttacgatacgctcgagccttcagcgatctgcacaa
ccagctgcatatcacgcctgccacagcctaccaaagcttcgagaacgtcatggatgaagtgttccgggacggtgtcaact
ggggccgcattgtagggctttttgcgttcggtggggcgctgtgcgtcgagtgtgtggagaaggagatgagtcagctggtg
ggaaggatcgtagagtggatgacagtctacctggacaaccacattcagccctggatccaaagccaaggaggatgggagcg
ctttgctgagctcttcggccacgacgcagcagcagagggcaggcggtctcaggagagtttcaagaagtggctgctggcag
gcatgaccctggtgactggggtcgtggtggggtcactcatagcgcagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1GZ93_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggttttctacataacatataaactatcccagagaaactatcctctcaaccacttggg
actcaatgagactcccaacaggactgatgggggggaagatgggttgagtgaggaacagcggatagcaacgcacgccaacg
ggacttttaatggtagaagtcccgggacccccccagcgtccccgctgcggcaacaacggttgccatcaacgacgagcctg
gatgcggtgaaagaggccctccgggactcggccaacgagtttgagttacgatacgctcgagccttcagcgatctgcacaa
ccagctgcatatcacgcctgccacagcctaccaaagcttcgagaacgtcatggatgaagtgttccgggacggtgtcaact
ggggccgcattgtagggctttttgcgttcggtggggcgctgtgcgtcgagtgtgtggagaaggagatgagtcagctggtg
ggaaggatcgtagagtggatgacagtctacctggacaaccacattcagccctggatccaaagccaaggaggatgggagcg
ctttgctgagctcttcggccacgacgcagcagcagagggcaggcggtctcaggagagtttcaagaagtggctgctggcag
gcatgaccctggtgactggggtcgtggtggggtcactcatagcgcagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1GZ93_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=699 residues).
atgtctcaaaacagagaactggtggttttctacataacatataaactatcccagagaaactatcctctcaaccacttggg
actcaatgagactcccaacaggactgatgggggggaagatgggttgagtgaggaacagcggatagcaacgcacgccaacg
ggacttttaatggtagaagtcccgggacccccccagcgtccccgctgcggcaacaacggttgccatcaacgacgagcctg
gatgcggtgaaagaggccctccgggactcggccaacgagtttgagttacgatacgctcgagccttcagcgatctgcacaa
ccagctgcatatcacgcctgccacagcctaccaaagcttcgagaacgtcatggatgaagtgttccgggacggtgtcaact
ggggccgcattgtagggctttttgcgttcggtggggcgctgtgcgtcgagtgtgtggagaaggagatgagtcagctggtg
ggaaggatcgtagagtggatgacagtctacctggacaaccacattcagccctggatccaaagccaaggaggatgggagcg
ctttgctgagctcttcggccacgacgcagcagcagagggcaggcggtctcaggagagtttcaagaagtggctgctggcag
gcatgaccctggtgactggggtcgtggtggggtcactcatagcgcagaaacgcctgtga
>gnl|bcl2dbcds|A0A3Q1I5N1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Anabas testudineus GN=BCL-2 (length=687 residues).
atggcgaacgagtgtaatcgcaatattgtagaaaagtatatctgccataaactctccaaacggggctacgcgtgggggtt
tcatgatgcccaagacgaagatgctgctaataatgggtctgcagttccccctccaccgactttggtccggcggtgccgtg
aagccagcaccgggcctgacagcgacagcatcccgcaacactgcagacggctccctccgtccgacccgcacgctgcgctc
cacagggtcctgcgtgaggctggagatgaacttgaaagactatatcagccggacttcacggagatgtcccgacagctgta
tctcacctccaccacggcgcagcggagattcgccgaggtgatagacgaactgttccgggacggggtgaactggggccgga
ttatcgctttcttcgagttcggcggcaccgtgtgcgtggagtgcgcgtccaaggaggagatgacaccgcaggtgaacaac
atcgcagagtggatgacggagtatttaaatggacctcttcacagctggatacaagataacgggggatgggatgccttcgt
ggacctgtatgacagacagagggagtctgtgttcagttgctcctggtcctccatcaagacggtcttcggcctcgctgctc
tcggggcagccagcctcaccattggagcttaccttgcacagaaatga
>gnl|bcl2dbcds|A0A3Q1IAB0_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L10 (length=732 residues).
atgttccaactctcatggggactttttcttctggaggcggagtcagcggataaatgtgcggacgctgaggggaaactgcg
agtgcaccgaggatctccttccgccgtccgtatgtgcagagagcagactgatatcgctgggaggaaaatgtcgtgtgggc
tgtggaaagacaccctggctctggcagaggactacctgtccctgtgctgcaccagcccttggccagcccctccacctccc
agcgagtcagccgctgccatgagacgtctggcccaggacatggagaagcagcatcaggttcgcttccactccctagctca
gactttcctgaagcagtgcgggccggacccctgctccagcctcaggaaggtgatggaggagctggtgggagatggacaca
tgaactgggggagggttgtttcccttttcaccttcactggggtgctggccagacagatgctggagcagaaggacaagaag
ccggggctggaccttgggaaggggcaggaactaggacaggagcctggacaatgtaggggactggcagagaccatagctga
ttacctgggagaagagaagaaagactggctgctggagaatgatggatgggaggggttctgtaagttctcctgcagtgcca
gagaagtgagccaggactcctccatgaagagagcgctgtttgctgctgctggtgtgggtcttgcgggactcaccttcctc
ctggtgcgctag
>gnl|bcl2dbcds|A0A3Q1JZ46_BCL2L1-02 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=660 residues).
atggaagaaatgtcgaacagtaacagagagctggtggagttcttcataatgtacaaactgtctcaaagaaaccacccagc
ctctcttctgaggccagatgataccggtggagtgggagacagacccaactcagcagctgctaacggcctgccggtcagca
ggagtggcgagctggggaactcgtcacctccgtgtaagagcatggaggccgtaaaaacagctcttagggactctgctgac
gagtttgaactgctcttcacacaagcgtttagtgacctttcctcgcagcttgatgtcacgcccgacacggcctatcaaag
ctttaagagtgtgatggacgagttgttcaaggatggagtcaactggggacgtatagtggggctgtttgccttcggtggcg
tgctgtgtgtggaatgtgtggagaagaatatgagtgagctggtatcccgaatcgcagactggatgaccatgtacctggat
gagcacatcagtccttggatccagagccagggaggatgggactgctttgctgagatatttgggcaagatgccgctgctga
ggcgaggagatctcgggaggctctgagaagatggctgctagttggagtggtgctgctcacgggagtgctgttaggtgtgc
tcattgctaagaaacggtga
>gnl|bcl2dbcds|A0A3Q1JZ46_BCL2L1-01 BCL2-like 1 gene OS=[Eukaryota] Anabas testudineus GN=BCL2L1 (length=660 residues).
atggaagaaatgtcgaacagtaacagagagctggtggagttcttcataatgtacaaactgtctcaaagaaaccacccagc
ctctcttctgaggccagatgataccggtggagtgggagacagacccaactcagcagctgctaacggcctgccggtcagca
ggagtggcgagctggggaactcgtcacctccgtgtaagagcatggaggccgtaaaaacagctcttagggactctgctgac
gagtttgaactgctcttcacacaagcgtttagtgacctttcctcgcagcttgatgtcacgcccgacacggcctatcaaag
ctttaagagtgtgatggacgagttgttcaaggatggagtcaactggggacgtatagtggggctgtttgccttcggtggcg
tgctgtgtgtggaatgtgtggagaagaatatgagtgagctggtatcccgaatcgcagactggatgaccatgtacctggat
gagcacatcagtccttggatccagagccagggaggatgggactgctttgctgagatatttgggcaagatgccgctgctga
ggcgaggagatctcgggaggctctgagaagatggctgctagttggagtggtgctgctcacgggagtgctgttaggtgtgc
tcattgctaagaaacggtga
© 1998-2019