Dataset for CDS BCL2L10 of organism Amphilophus citrinellus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|A0A3Q0S9R1_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Amphilophus citrinellus GN=BCL2L10 (length=576 residues).
atggtccctgggctgtggaaagaaaccctgggtttggctgaggactacctgtctctgtgctgcacaagtccacatcaagt
ccctccacctcccagcgagtcagccgctgccatgagacgtctgggccaggatattgagcggcagcaccaggctcgctttg
acaaccttgctcagaccttcctgaggcattgcgggccggatcactgctctagcctcaggaaggtgatggaggagctggtg
ggagacggacacttgaactgggggagggttgtttccctttttgcttttactggggtgctagccagaaagaggctggagca
gaagccagggctggaccctgggcaacagcaggaactgggacaggagcccataagctgcagggagctggcagagaccatag
ctgattacctgggggaagagaagaaagactggctcttggacaatgatggatgggagggtttctgtaagtactcccgcagt
gccagagaggtgagccaggactcttccatgaagaccgcgctgtttgctgctgctggcgtcggcctggccgggcttacttt
ccttttggtgcgctag
© 1998-2019