Dataset for CDS BCL-2-like of organism Ailuropoda melanoleuca

[Download (right click)] [Alignment] [Repertoires]

6 sequence(s)

>gnl|bcl2dbcds|G1L3M8_MCL1-01 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=MCL-1 (length=1005 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcagcggcgg
gggggnatcgggagggcggcttttggcttcggggaaggaggccacggcccggagggagatagggggaggggaagccggtg
cggtgattggcggaagcgccggcgctagtcccccggntggcgccgagggtcccgacgtcacggcgacccccccgaggcta
ctgttcctcgagcccacccgccgcgcgtcgccgcctgaagagatggaaggcccagccgccgacgccatcatgtcgcccga
agaggagctggacgggtacgagccggaacctttggggaagcggccggctgtcctgcctttgctggagttggtcggggagg
ccagcggtggcccttgtacggacggctcactgccctcgacgccacccccagcagaggaggaggaagacgagttgtaccgg
cagtcgctggagattatctctcggtaccttcgggagcaggcaacaggcgccaaggacgcgaaaccgctgggcgggtctgg
ggcggccagccggaaggcgttagagaccctccgacgggtcggggacggggtacagcgcaaccacgagacggccttccaag
gcatgcttcggaaactggacatcaaaaatgaagacgatgtcaaatctttgtctcgagtgatggtccatgttttcagtgac
ggagtaacaaactggggcaggattgtgactcttatttcttttggtgcctttgtggccaaacacttgaagagtataaacca
agaaggctgcatcgaaccattagcagaaagcatcacagatgttctcgtaaggacaaaacgagactggctagtcaaacaaa
gaggctgggatgggtttgtggagttcttccatgtagaggacctagaaggtggcatcagaaatgtgctgctggcttttgca
ggtgttgctggagtaggagctggtttggcatatctaataagatag
>gnl|bcl2dbcds|G1L3M8_MCL1-02 Myeloid cell leukemia sequence 1 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=MCL-1 (length=1041 residues).
atgtttggcctcaaaagaaacgcagtaatcggactcaacctctactgtgggggggccgggttgggggccggcagcggcgg
gggggnatcgggagggcggcttttggcttcggggaaggaggccacggcccggagggagatagggggaggggaagccggtg
cggtgattggcggaagcgccggcgctagtcccccggccnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnntggc
gccgagggtcccgacgtcacggcgacccccccgaggctactgttcctcgagcccacccgccgcgcgtcgccgcctgaaga
gatggaaggcccagccgccgacgccatcatgtcgcccgaagaggagctggacgggtacgagccggaacctttggggaagc
ggccggctgtcctgcctttgctggagttggtcggggaggccagcggtggcccttgtacggacggctcactgccctcgacg
ccacccccagcagaggaggaggaagacgagttgtaccggcagtcgctggagattatctctcggtaccttcgggagcaggc
aacaggcgccaaggacgcgaaaccgctgggcgggtctggggcggccagccggaaggcgttagagaccctccgacgggtcg
gggacggggtacagcgcaaccacgagacggccttccaaggcatgcttcggaaactggacatcaaaaatgaagacgatgtc
aaatctttgtctcgagtgatggtccatgttttcagtgacggagtaacaaactggggcaggattgtgactcttatttcttt
tggtgcctttgtggccaaacacttgaagagtataaaccaagaaggctgcatcgaaccattagcagaaagcatcacagatg
ttctcgtaaggacaaaacgagactggctagtcaaacaaagaggctgggatgggtttgtggagttcttccatgtagaggac
ctagaaggtggcatcagaaatgtgctgctggcttttgcaggtgttgctggagtaggagctggtttggcatatctaataag
a
>gnl|bcl2dbcds|G1LID1_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL-2 (length=489 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcggcccccgccgccgccgccgccgcgggccctgcgctcagccccgtgccacctgtgg
tccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagctg
cacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatggggtgaactgggggag
gattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaaca
ttgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggtaggtgcacgt
ccgcttgaa
>gnl|bcl2dbcds|G1LID1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL-2 (length=549 residues).
ccccaccccgcagcgtccccccggcccttcgtgaggcgctggcaggtggcgccgccaagcgccgccgccgccgccgcggg
ccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgcc
gcgacttcgcggagatgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggag
ctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaa
ccgggagatgtcgcccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatcc
aggacaacggaggctgggatgcctttgtggagttgtacggccccagcatgcagcctctgtttgacttctcctggctgtct
ctgaaggccctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaag
>gnl|bcl2dbcds|G1LKR4_BCL2L10-01 BCL2-like 10 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L10 (length=582 residues).
atggcggacgcgttgaggggcacggcgcggctgctgaccgactacctggagtactgcgcccgggagcccggcacccctgc
gcgggcgccgtccacgcccgaggccgcggtgctgcgttcggtggccgcccaggtacagcagcgtcacgagcgcttcttgt
ccgattaccgcggctacgccggcggcaaccgcgtggagctggtggctcaggtggagcgggagatactcgcccacccccag
cccctaagctggggccgtgtggtggcgctcttgaccttcgcgggcacactgctggagagatcgccgtcggggacctactc
gaacctggggccggaccaggaactggagctgggggagtgggaggccggcgtccgccaggactgccggcacctggtggact
tcctctgcaatcggctcacgggacagcatcgcgcctggctggaggcgcacgacggctgggatggcttttgtctcttcttc
acacccatgctgccgtcgtcttggaaaagactgctggcccaggctcttctgtcctgcttcacagcggtgatcttaatcta
cttctggaaaaggttattgtga
>gnl|bcl2dbcds|G1LMC3_BCL2L2-01 BCL2-like 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL2L2 (length=630 residues).
ccatatattcatgccagtctttcatccttgactcttacagccgcccggatggcgaccccagcttcagccccagacacacg
ggctctagtggcagactttgtaggctataagctgaggcagaaaggttatgtgtgtggagctggccctggggagggcccag
cagctgacccactgcaccaagccatgcgggcagctggagatgagtttgagacccgcttccggcgcaccttctctgatttg
gcagcccagctgcatgtgaccccaggctcagcccagcaacgcttcacccaggtctctgatgaactcttccaagggggccc
caactggggccgcctggtggccttctttgtctttggagccgcactgtgtgctgagagtgtcaacaaagagatggaaccac
ttgtgggacaagtgcaagagtggatggtggcctacctggagacacggctggctgactggatccacagcagtgggggctgg
gcggagttcacagctctatacggggacggggccctggaggaggcgcggcgtctgcgggaggggaactgggcctcagtgag
gacagtgctgacaggggccgtggcactgggggccctggtaactgtaggggccttttttgctagcaagtga
© 1998-2018