Dataset for CDS BCL-2 of organism Ailuropoda melanoleuca

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|G1LID1_BCL2-02 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL-2 (length=489 residues).
atggcgcacgctgggagaacagggtatgataaccgggagatagtgatgaagtacatccactataagctgtcgcagagggg
ctacgagtgggatgccggagacgcggcccccgccgccgccgccgccgcgggccctgcgctcagccccgtgccacctgtgg
tccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgccgcgacttcgcggagatgtccagccagctg
cacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggagctcttcagggatggggtgaactgggggag
gattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaaccgggagatgtcgcccctggtggacaaca
ttgccctgtggatgactgagtacctgaaccggcacctgcacacctggatccaggacaacggaggctgggtaggtgcacgt
ccgcttgaa
>gnl|bcl2dbcds|G1LID1_BCL2-01 B-cell CLL/lymphoma 2 gene OS=[Eukaryota] Ailuropoda melanoleuca GN=BCL-2 (length=549 residues).
ccccaccccgcagcgtccccccggcccttcgtgaggcgctggcaggtggcgccgccaagcgccgccgccgccgccgcggg
ccctgcgctcagccccgtgccacctgtggtccacctgaccctgcgccaggccggcgatgacttctcccgtcgctaccgcc
gcgacttcgcggagatgtccagccagctgcacctgacacccttcaccgcaaggggacgctttgccacggtggtggaggag
ctcttcagggatggggtgaactgggggaggattgtggccttctttgagttcggtggggtcatgtgtgtggagagcgtcaa
ccgggagatgtcgcccctggtggacaacattgccctgtggatgactgagtacctgaaccggcacctgcacacctggatcc
aggacaacggaggctgggatgcctttgtggagttgtacggccccagcatgcagcctctgtttgacttctcctggctgtct
ctgaaggccctgctcagtctggccctggtgggagcttgcatcaccctgggtgcctacctgggccacaag
© 1998-2018