Dataset for CDS Unclassified of organism Acropora millepora

[Download (right click)]

2 sequence(s)

>gnl|bcl2dbcds|B7SB93_uncBCL2L2-01 Putative BCL2-like 2 gene OS=[Eukaryota] Acropora millepora (length=561 residues).
atggtacacaacaacgaccgtttgaggtctttcaataccattgtcaaagactatgtaggatacaaacttcgtcaaaaaaa
tatatttctggatgggtataatgtgaacgagagtccttcggcagcagcgtgtcatttgcggcgagtggcggacgaactca
tagaagagaatagacagttgttcgactccatgtgtgatcaacttcatcttacacacgcttctacttatgccacatttgtc
ggaattgcggacgaaatttttcagacagggaaaaactggggtcgcattgttgcttttctggcttttggagccacgttggc
tgtgtattgtgttcaaaaagaggatctcgcagaacttcttgacaacattattgaatggctctctttgtatatggagcaaa
atcttggccaatggattaacgagaatggcggatgggaagggtttattcagttcttcaaaaaagaggatggctctccagga
aatggacgaaatggaggatggcgcattgctgctgttgcaggacttgggattggtgctcttctgatgctagcttgtagata
a
>gnl|bcl2dbcds|B7SB94_uncBCL2L1-01 Putative BCL2-like 1 gene OS=[Eukaryota] Acropora millepora (length=636 residues).
atggccggagcaacagctgcgctgaacaacgaagatctttccccaacactgagcacctcggaattgtcaagatacgacaa
ggatatcgtcaacgatggttactcactaactgtggactatgtttcttaccgactaaggaacaaattcgaacaaaacaaac
tcagtggattaccgcgaaaattccttattcctcaatcacctataagcgcatcatcgagtaatctacgaaaactggcgact
cttatggaggctgaacaccccgacttgttcgaatcattgtgtacaacgctaggaataacaccaaatacagcgcatcctac
gtttgtcggtgttgcacaagaaatctttcaagccggaatcaactggggcagaatagtggcccttttcacgttcggaggtg
tagtggctcatcacttcgtggaaattcagcgactagaaatggtgcaacgcatcgtggaatggatcgctgactttattgaa
cataacttgctgacatggatcagagagaatggtggctgggatggatttgttgctcacttttccgactcctcgcagtctca
attcacatggaagagcttagtcactgttggaagtatttgtgcagcgggtcttactcttctggcattaaacaagtga
© 1998-2018