Dataset for CDS BOK of Organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|A0A287AST0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Sus scrofa GN=BOK (length=642 residues).
atggaagtgctgaggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggccctcggccgggagttcgtgcacgcgcggctgctgcgcgccggcctcgcctggaacgcgcccg
agcgcgccgcgcccgcccccggcggccgtctggccgaggtgtgcgcggtgctgctgcgtctggcggacgagctggagctg
attcggcccagtgtctatcgcaacgtggcccgccagctgaacctctccctgcagtccgagaccgtggtgaccgacgcctt
cctcgccgtggcggcccagatcttctctgcaggcatcacgtgggggaaggtggtgtccctctactcagtggctgcggggc
tggccgtggactgcgtgcggcaggcccagcccgccatggtccatgcccttgtcgactgcctcggggagtttgtgcgcaag
accctggcgacctggctgcggaggcgcggcggatggacggaccttctcaagtgcgtggtcagtgccgaccccggccgccg
ctcccactggctcgtggccgcgttctgcagcttcggccgcttcctgaaggctgccttcttcctgctgctgccggagagat
ga
>gnl|bcl2dbcds|A0A287AST0_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Sus scrofa GN=BOK (length=642 residues).
atggaagtgctgaggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggccctcggccgggagttcgtgcacgcgcggctgctgcgcgccggcctcgcctggaacgcgcccg
agcgcgccgcgcccgcccccggcggccgtctggccgaggtgtgcgcggtgctgctgcgtctggcggacgagctggagctg
attcggcccagtgtctatcgcaacgtggcccgccagctgaacctctccctgcagtccgagaccgtggtgaccgacgcctt
cctcgccgtggcggcccagatcttctctgcaggcatcacgtgggggaaggtggtgtccctctactcagtggctgcggggc
tggccgtggactgcgtgcggcaggcccagcccgccatggtccatgcccttgtcgactgcctcggggagtttgtgcgcaag
accctggcgacctggctgcggaggcgcggcggatggacggaccttctcaagtgcgtggtcagtgccgaccccggccgccg
ctcccactggctcgtggccgcgttctgcagcttcggccgcttcctgaaggctgccttcttcctgctgctgccggagagat
ga
© 1998-2018