Dataset for CDS BAX-like of Organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

7 sequence(s)

>gnl|bcl2dbcds|A0A287AST0_BOK-01 BCL2-related ovarian killer gene OS=[Eukaryota] Sus scrofa GN=BOK (length=642 residues).
atggaagtgctgaggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggccctcggccgggagttcgtgcacgcgcggctgctgcgcgccggcctcgcctggaacgcgcccg
agcgcgccgcgcccgcccccggcggccgtctggccgaggtgtgcgcggtgctgctgcgtctggcggacgagctggagctg
attcggcccagtgtctatcgcaacgtggcccgccagctgaacctctccctgcagtccgagaccgtggtgaccgacgcctt
cctcgccgtggcggcccagatcttctctgcaggcatcacgtgggggaaggtggtgtccctctactcagtggctgcggggc
tggccgtggactgcgtgcggcaggcccagcccgccatggtccatgcccttgtcgactgcctcggggagtttgtgcgcaag
accctggcgacctggctgcggaggcgcggcggatggacggaccttctcaagtgcgtggtcagtgccgaccccggccgccg
ctcccactggctcgtggccgcgttctgcagcttcggccgcttcctgaaggctgccttcttcctgctgctgccggagagat
ga
>gnl|bcl2dbcds|A0A287AST0_BOK-02 BCL2-related ovarian killer gene OS=[Eukaryota] Sus scrofa GN=BOK (length=642 residues).
atggaagtgctgaggcgctcctcggtcttcgccgccgagatcatggacgcctttgaccgctcgcccaccgacaaggagct
ggtggcccaggccaaggccctcggccgggagttcgtgcacgcgcggctgctgcgcgccggcctcgcctggaacgcgcccg
agcgcgccgcgcccgcccccggcggccgtctggccgaggtgtgcgcggtgctgctgcgtctggcggacgagctggagctg
attcggcccagtgtctatcgcaacgtggcccgccagctgaacctctccctgcagtccgagaccgtggtgaccgacgcctt
cctcgccgtggcggcccagatcttctctgcaggcatcacgtgggggaaggtggtgtccctctactcagtggctgcggggc
tggccgtggactgcgtgcggcaggcccagcccgccatggtccatgcccttgtcgactgcctcggggagtttgtgcgcaag
accctggcgacctggctgcggaggcgcggcggatggacggaccttctcaagtgcgtggtcagtgccgaccccggccgccg
ctcccactggctcgtggccgcgttctgcagcttcggccgcttcctgaaggctgccttcttcctgctgctgccggagagat
ga
>gnl|bcl2dbcds|F1RIQ4_BAX-01 BCL2-associated X gene OS=[Eukaryota] Sus scrofa GN=BAX (length=522 residues).
atgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatggggggagagacacctgagctggg
cctggagcaggtgcctcaggatgcatctaccaagaagttgagcgagtgtctcaagcgcattggagatgaactggacagta
acatggagctgcagaggatgatcgcagccgtggacacggactccccccgagaagtctttttccgagtggcggccgaaatg
tttgctgacggcaacttcaactggggccgggtggtcgcgcttttctactttgccagtaaactggtgctcaaggccctgtg
caccagggtgcccgaactgatcaggaccatcatgggctggacgctggacttccttcgagatcggctgctgggctggatcc
aggaccagggtggttgggacggcctcctctcctactttgggacgcccacgtggcagacggtgaccatcttcgtggccgga
gtgctcaccgcctcgctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|F1RIQ4_BAX-02 BCL2-associated X gene OS=[Eukaryota] Sus scrofa GN=BAX (length=522 residues).
atgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatggggggagagacacctgagctggg
cctggagcaggtgcctcaggatgcatctaccaagaagttgagcgagtgtctcaagcgcattggagatgaactggacagta
acatggagctgcagaggatgatcgcagccgtggacacggactccccccgagaagtctttttccgagtggcggccgaaatg
tttgctgacggcaacttcaactggggccgggtggtcgcgcttttctactttgccagtaaactggtgctcaaggccctgtg
caccagggtgcccgaactgatcaggaccatcatgggctggacgctggacttccttcgagatcggctgctgggctggatcc
aggaccagggtggttgggacggcctcctctcctactttgggacgcccacgtggcagacggtgaccatcttcgtggccgga
gtgctcaccgcctcgctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|F1RZR2_BAK1-03 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Sus scrofa GN=BAK1 (length=636 residues).
atggcgtccggccaaggcccaggcccccccaggcagggctgtggagagcccgacccctcgtccacatcagaggagcaggt
ggcccgggacacggaggaggttttccgcagctacgtttttcaccgccatcagcaggagcaggaggccgagggggcagctg
cgcccaccgacccagagatggtcaccctgcccctagaacctagcagcaccatggggcaggtaggccgccagctcgccatc
attggggatgacatcaaccggcgatacgactcggaattccaggccatgctgcagcacctgcagccgacagcggaaaacgc
ctatgagtacttcaccaagatcgcctccagcctgttcgagagtggcatcaactggggccgagtggtggctcttctgggct
ttggctaccgcctggccctgtacgtctaccagaggggcctgaccggcttcctaggccaggtgacccgctttgtggccgac
ttcatgctgcatcactgcatcgcccggtggattgcgcagaggggtggctgggtggcagccctggatttgggaaacggccc
catccggaacgtgctgctagttctggctgtggttttgctgggccagtttgtggtacgcagattcttcaggtcatga
>gnl|bcl2dbcds|F1RZR2_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Sus scrofa GN=BAK1 (length=636 residues).
atggcgtccggccaaggcccaggcccccccaggcagggctgtggagagcccgacccctcgtccacatcagaggagcaggt
ggcccgggacacggaggaggttttccgcagctacgtttttcaccgccatcagcaggagcaggaggccgagggggcagctg
cgcccaccgacccagagatggtcaccctgcccctagaacctagcagcaccatggggcaggtaggccgccagctcgccatc
attggggatgacatcaaccggcgatacgactcggaattccaggccatgctgcagcacctgcagccgacagcggaaaacgc
ctatgagtacttcaccaagatcgcctccagcctgttcgagagtggcatcaactggggccgagtggtggctcttctgggct
ttggctaccgcctggccctgtacgtctaccagaggggcctgaccggcttcctaggccaggtgacccgctttgtggccgac
ttcatgctgcatcactgcatcgcccggtggattgcgcagaggggtggctgggtggcagccctggatttgggaaacggccc
catccggaacgtgctgctagttctggctgtggttttgctgggccagtttgtggtacgcagattcttcaggtcatga
>gnl|bcl2dbcds|F1RZR2_BAK1-02 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Sus scrofa GN=BAK1 (length=636 residues).
atggcgtccggccaaggcccaggcccccccaggcagggctgtggagagcccgacccctcgtccacatcagaggagcaggt
ggcccgggacacggaggaggttttccgcagctacgtttttcaccgccatcagcaggagcaggaggccgagggggcagctg
cgcccaccgacccagagatggtcaccctgcccctagaacctagcagcaccatggggcaggtaggccgccagctcgccatc
attggggatgacatcaaccggcgatacgactcggaattccaggccatgctgcagcacctgcagccgacagcggaaaacgc
ctatgagtacttcaccaagatcgcctccagcctgttcgagagtggcatcaactggggccgagtggtggctcttctgggct
ttggctaccgcctggccctgtacgtctaccagaggggcctgaccggcttcctaggccaggtgacccgctttgtggccgac
ttcatgctgcatcactgcatcgcccggtggattgcgcagaggggtggctgggtggcagccctggatttgggaaacggccc
catccggaacgtgctgctagttctggctgtggttttgctgggccagtttgtggtacgcagattcttcaggtcatga
© 1998-2018