Dataset for CDS BAX of Organism Sus scrofa

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|F1RIQ4_BAX-01 BCL2-associated X gene OS=[Eukaryota] Sus scrofa GN=BAX (length=522 residues).
atgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatggggggagagacacctgagctggg
cctggagcaggtgcctcaggatgcatctaccaagaagttgagcgagtgtctcaagcgcattggagatgaactggacagta
acatggagctgcagaggatgatcgcagccgtggacacggactccccccgagaagtctttttccgagtggcggccgaaatg
tttgctgacggcaacttcaactggggccgggtggtcgcgcttttctactttgccagtaaactggtgctcaaggccctgtg
caccagggtgcccgaactgatcaggaccatcatgggctggacgctggacttccttcgagatcggctgctgggctggatcc
aggaccagggtggttgggacggcctcctctcctactttgggacgcccacgtggcagacggtgaccatcttcgtggccgga
gtgctcaccgcctcgctcaccatctggaagaagatgggctga
>gnl|bcl2dbcds|F1RIQ4_BAX-02 BCL2-associated X gene OS=[Eukaryota] Sus scrofa GN=BAX (length=522 residues).
atgaagacaggggcccttttgcttcagggtttcatccaggatcgagcagggcgaatggggggagagacacctgagctggg
cctggagcaggtgcctcaggatgcatctaccaagaagttgagcgagtgtctcaagcgcattggagatgaactggacagta
acatggagctgcagaggatgatcgcagccgtggacacggactccccccgagaagtctttttccgagtggcggccgaaatg
tttgctgacggcaacttcaactggggccgggtggtcgcgcttttctactttgccagtaaactggtgctcaaggccctgtg
caccagggtgcccgaactgatcaggaccatcatgggctggacgctggacttccttcgagatcggctgctgggctggatcc
aggaccagggtggttgggacggcctcctctcctactttgggacgcccacgtggcagacggtgaccatcttcgtggccgga
gtgctcaccgcctcgctcaccatctggaagaagatgggctga
© 1998-2018