Dataset for CDS Unclassified of Organism Strongylocentrotus purpuratus

[Download (right click)]

3 sequence(s)

>gnl|bcl2dbcds|W4XRT0_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=942 residues).
atgacggagatatgtgggtttgtgagcattctccgttttagcgctaagatcttggctggtaaagatttctgtgactgtga
gtgcaggttggtggatggtgcagcgatggactacctcaagacagacatcctgactcacttgcgcgagggtctcctggaca
cctgccggcaccacatccatttcctctcctgccatctcaaacactcttccaatggtctctaccagctgggtcaacggctc
aacgagaaagtcagtatccgcagccgtagactcctccacagccctccgacagaagatgacgttgtcaaccaagcgaaagt
cctgtgccgagactatgcctacgtgaaactcagaaagcacaaactcctgtccagagacatctacgggaaagcaggaaagc
gaggtccccatcagatacagttcttgaggcagaaggcggagagagatgcccagtcgggtcaagtgaagaccaggttcggt
gatcctgggatcggaccatctgatgtgtctaaggaactcatcaaggtggccacagaatttgaaaagtgcttcccgtattt
gtatgaggacattactgaacaattacaactcaacttccagtcgccagccaatatccttagtgtctacaatacagttggag
cagatatattcaggaaaggtatcacgtgggcaagaatcgtagccttgtacaccctgacaggcgccctcatcgttgagtgc
gtgaagcagggtcagcacagccaggctaacgcactggtagacgcattgcagaagttggttcggaagaggcttgccagatg
gatcatcgaccaaggaggatggattgggctggtggtacatttccgacagaagcagtcttctatcacggtgctacgggtat
taagcttggtagggttgctcctaggtgtggtcctggtgttttggtgtccccgacgaacatag
>gnl|bcl2dbcds|W4YZY3_uncBOK-01 Putative BCL2-related ovarian killer gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=858 residues).
atgtccaacacgggagagtcaacaccaagctatatctcactcctcaagcgagcgtcattcagaagacaacccgactatgt
caaggtggctgccaaaattgaggaggagattcgactccgtgaccttcaggaaaaatccctgtcgacccgagtaaatcatc
ttaagaatcgttattcggataagattcattacgtaacgaagaccatcgaatggaagatgggtggtctaggtctaccttgg
gtagccagagtggacgatgtgtgggaccagagtgccgtgtactgtaaggagtttatccattcgaagctgaagcggctggg
ctacatgggcggcagcacgaagaatggggttcgaggttcggtggcggctcgtggtcaacgagtctcgcctgtctgccggg
agctcaccctagtcgggtccgagctcgaacgaatgtaccccactctctacaaggacatcaccaagcagctcaacgtcacg
atctcaagcgagcagatcctcgagcaggtgctcttcgacgtcggcgacgccgtgttcaaagcggggatcacctgggcgag
ggtcgtcgcgttcttcgttgtgtcctcatcgttatcagtggagtgcatgcaacaaggaaatggaatcttcgtccacagta
tcacagtggctctcaccagatacgtacaaacaaaacttgtcaaatggataacacaacgaggtggctggacggatctcttg
cggacgttccgccgcaaaagaaacgactcgggaactgtctggctcttgacgtttgggggcgtctttctcggtctgttctt
aactgcgttgttgtcgcatgctccgtattacctctctgcttggcggcccgagaattga
>gnl|bcl2dbcds|W4ZK86_uncBAX-01 Putative BCL2-associated X gene OS=[Eukaryota] Strongylocentrotus purpuratus (length=945 residues).
atggaagaaaaacaatcaccaaaaaagaccatgagaaatggtaatggccatcaagcaccctcctcgttaccatctacagg
aggggcaaacctttatccaaatggtcacggagagccagagatgtctccaacgtcaaaggaattccgggagagcagcttcg
caaaccggagaaagtcgtcacaaatgctgtctccgttgagaatgagaaagatgccccaaggcgtggactcgattgatgga
gtggaggatagatgcgaggtggaggaggaaggggtggtgttgtttaattgctttctggagggagaacttgcaaggagtgg
tatcccggagacaaaggtcatcgagacagcagtgacaagtgctaccttagaatccaaacagaaagagccagcagtgaatg
tttctgccttccaattcaatccacaagttgattcaacgaagatgagtgcaaacggaagctttaccccttcactccagatg
tacaagaatcccagatgggccaagagcgggagagatctgaagaaacttgcagaccagtttgcctcctcgagggagagaga
tggagtcagagcaaaggctagagagacggtaggggacaatgaaatctcagcggccatgttctgggatctactctcggagc
ttttcttccagggtaccatcaccagggagaggatcgtcgtcctcttcttcttctgcagtgacgtcgccatctttgccctc
cagaggaacagcatcgactacttccaccgcttcatggtgtgggcccttcagtacatccgaagccgagtctgcacgtgggt
agccgacaatggaggatgggaggcagtactctacctatcagccaacaagttcatcttcttcgggaagatcgctctcggat
gtgccgtagcatatggtgcctacaagattgatcagtcagatgttgctcttgaaccacccctgtaa
© 1998-2018