Dataset for CDS BAX-like of Organism Strongylocentrotus purpuratus

[Download (right click)] [Alignment] [Repertoires]

2 sequence(s)

>gnl|bcl2dbcds|W4Y4K1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Strongylocentrotus purpuratus GN=BAX (length=651 residues).
atgtactgcaacagaaattgtgactcatcaacgacaagtttgcattttgagcagacacgtatccaacttgaacgccaagt
gagccgtgatgacgttggggagcaagcgactgttctccttcagcatttcatcgtagaacgattccagcaggatggttttg
ccgatgctccggggctggatgacctgagggcggggctcgctgtgccgagtgagcaagaggttgtctggtcagaggtcggg
gtcatgttgaggtcaatcggagacacgttagacagggatcgagagctgcagaggatgataagctctgttccagtcgactc
acccatcgaggccatcatagcagtggcacatgtcatctttggagatggtgatatcacatggggtagaatagtaggtctct
tctactttgcttacaggatgtgtgctagggcaatagaaacaattatggataagagttttcctagctggatcaacaagctg
atcaaggaagtcgtcaagttccttgttatcaaattcgcccactggattgttaacaagggtggatggctggccatccgtga
atatatgggctcaccgacctggatatgggggaccctcatgacactctctgctagctgtctcatcttctccttctacaagc
taagtagatga
>gnl|bcl2dbcds|W4YE49_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus GN=BAK1 (length=630 residues).
atggcaacgggtacctctacgattacccagacggtgcaggaggacacggaggagaacgtgattgaacagacggagatgat
cgtcagaaacttcttccaccagaggctggcgatggacatgcaggatcagacgaatgatattaatatatcaacgcctagga
taccagagttacagaatttcactgcagaccctttaagtccgacgtcgagagtagggaggagactagctcagattggagac
caaatagatgcacagtacgagggagagttccgtcagatgatccagatgctacacataaccccctcaaccgcctatcaagc
attcgccggtgtagcaagaagattatttatcaagggcatcaactgggggcgtatttcggcgcttctcatgttcggttacc
gtatcgctagagacgtgatgacgagtgtgggggatttctttcacaagattgtcggcgatctggtgcgtttcatcatctca
gagagaatcgcaacatggatagcacaacaaggaggctggatttcagcgctgaacttcagaatagagaaccccggtgtagg
cttcattgcaatagcaggtctgtcagcgttagccatcgtgtgtgcagtcgtatggtcaagatctagatag
© 1998-2018