Dataset for CDS BAX of Organism Strongylocentrotus purpuratus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W4Y4K1_BAX-01 BCL2-associated X gene OS=[Eukaryota] Strongylocentrotus purpuratus GN=BAX (length=651 residues).
atgtactgcaacagaaattgtgactcatcaacgacaagtttgcattttgagcagacacgtatccaacttgaacgccaagt
gagccgtgatgacgttggggagcaagcgactgttctccttcagcatttcatcgtagaacgattccagcaggatggttttg
ccgatgctccggggctggatgacctgagggcggggctcgctgtgccgagtgagcaagaggttgtctggtcagaggtcggg
gtcatgttgaggtcaatcggagacacgttagacagggatcgagagctgcagaggatgataagctctgttccagtcgactc
acccatcgaggccatcatagcagtggcacatgtcatctttggagatggtgatatcacatggggtagaatagtaggtctct
tctactttgcttacaggatgtgtgctagggcaatagaaacaattatggataagagttttcctagctggatcaacaagctg
atcaaggaagtcgtcaagttccttgttatcaaattcgcccactggattgttaacaagggtggatggctggccatccgtga
atatatgggctcaccgacctggatatgggggaccctcatgacactctctgctagctgtctcatcttctccttctacaagc
taagtagatga
© 1998-2018