Dataset for CDS BAK1 of Organism Strongylocentrotus purpuratus

[Download (right click)]

1 sequence(s)

>gnl|bcl2dbcds|W4YE49_BAK1-01 BCL2-antagonist/killer 1 gene OS=[Eukaryota] Strongylocentrotus purpuratus GN=BAK1 (length=630 residues).
atggcaacgggtacctctacgattacccagacggtgcaggaggacacggaggagaacgtgattgaacagacggagatgat
cgtcagaaacttcttccaccagaggctggcgatggacatgcaggatcagacgaatgatattaatatatcaacgcctagga
taccagagttacagaatttcactgcagaccctttaagtccgacgtcgagagtagggaggagactagctcagattggagac
caaatagatgcacagtacgagggagagttccgtcagatgatccagatgctacacataaccccctcaaccgcctatcaagc
attcgccggtgtagcaagaagattatttatcaagggcatcaactgggggcgtatttcggcgcttctcatgttcggttacc
gtatcgctagagacgtgatgacgagtgtgggggatttctttcacaagattgtcggcgatctggtgcgtttcatcatctca
gagagaatcgcaacatggatagcacaacaaggaggctggatttcagcgctgaacttcagaatagagaaccccggtgtagg
cttcattgcaatagcaggtctgtcagcgttagccatcgtgtgtgcagtcgtatggtcaagatctagatag
© 1998-2018